GenePrediction:GLEAN_6385 Details

Name: GLEAN_6385
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:448084..445440 (- strand)
Length: 2645
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:448084..447897 (- strand)
Length: 188
Type: CDS
Source: GLEAN
Position: GCSC_144:447825..447748 (- strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_144:447678..447212 (- strand)
Length: 467
Type: CDS
Source: GLEAN
Position: GCSC_144:447156..447015 (- strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_144:446958..446652 (- strand)
Length: 307
Type: CDS
Source: GLEAN
Position: GCSC_144:446581..446288 (- strand)
Length: 294
Type: CDS
Source: GLEAN
Position: GCSC_144:446228..445842 (- strand)
Length: 387
Type: CDS
Source: GLEAN
Position: GCSC_144:445787..445440 (- strand)
Length: 348
>GLEAN_6385 class=GenePrediction position=GCSC_144:448084..445440 (- strand)
ATGAAGAGTCCTGTCCTATCACAGAGTAGTGGGGAACAGAAGCTGGAGGAAGGGCTGGAACGGGGCCTGGACGACCAGCC
GCTGCGGCGCCAAAACGACCTTGGTCCAGAAACAGGCGTCGCAAAACCGGTAACAGCCTGCTTCCACTGCCGGGCATTGC
GACAGAAATGCGACCGGAAGTTGCCGTGGTAAGCCTGCACCACCTCGCGCATCCATGTCTGGCCCACACGATGCTGACAG
CAGATGTCCGCTCTGGCAGCTCCCGCTGCTCAGCCCGACAAAGGCCGTGTCGCTATCCGTCTGGTTCTAACCGTGGCCGG
AAGCCCAATACGGCCATGTATGTGTTCGCCTGGCCTGACTCTGTTCGACTGCTGGTCCAGGGCTGACGGAATCTCACTCT
CGGCAGAAGCCACTCAGTCTCGGTCGACAAGCTCCTGTCCCGCATAAGCGAGACTGCTGAGCGAGATCAGGTGGTCGCGG
CCCTGCTTGACTTTGCTGGCGGCCAGTATCAGGACATCCAGCGGAATGCTGCTGCTGTCGCTGCTGCTACCGCTGCTGCC
GCCTCCTCACCGCCGCCGGCTGCACTCGGGGCAGACAAGGATGGTGCAGACGCGAGCCCGCCCGATCGCCGGGAAACCCG
TTCTCTCTCCCCGAACCATCATCGCCATTCAGGGAGCTACTCCCGACCACCTCATGCTGCCGGCACCGCGTCCGAGCCCG
AGTTCCAGGCCTCCCTTGTGTCCTCCTTTCAGATCGTCGCTGCGGCCATCGCGGCCGATTCGGCCTCCTTTCACCAAAGT
CCGGGCTCGCCGGTCATGTCGGCCATCCGGAGTCGCAAGGATTTTGTAGACGAGCGCCTGGCGCGGTATTTTGGTAAGAA
CACTATACGCACATCTGTCTGGCCGAAACAGCTAATGTACCGGTCCAGCCACACAAATCACACAGCAAAAAGACTGGCAG
GTCTTGGCTGGCCAATCTATCGACAGTCCTCTGAAGCTGGAGACGTCGACGTGCGACCCCGTGGCAGCCCGGTTGATCGA
TCACAACGATGTCACGCGCTATTTCCAGTTGTGCGTCGACTCTTTATAGACCTCTCTCTTCCTCGCCTGGCCTAACCCTA
TTCAAGGTTCTTCAAGTACCGCAGTCCACTCATCGGGATTCTGGATCCTGCCCTGCACACGCCCGAGTATGTACATGAGT
CCTCCTTTGTCCTCTTCTCGGCTCTCTGCGCCCTCGGATGTGCCGTGTCCGATCGACCTCGTGACCGCGTCGTCTATCCG
GCACTCATGTCTCTGGCCGAGGGAAACATGAAGTGGGCCATCGCGGTCTGCGTCAAATCGCTCGAGATCATCCAGGCCAT
CATCTGCATGCAGTACTGGGCGCCCGTCTGCCAGAAGCAGTCAGACGACCCGTACTGGCTGCGCCTGAGTCATGTGAGAA
AGCTGCCGAACAACTGCCATACATTATAGGACCTTCTTGTGCTGACGTCATCGATCTGTACAGGCTGTTCAGCTGGGACG
CGAACTCGGCATCAACCGATCTGCCGTGATAGCTGAGCACGTCCAGGCCATTGCTGGAAATGAGAGTGCCGAGTTCAGGG
AGCGCCTTGTGCGTGACTTTGAGCGGACTTGGCTCTGTACCTTTATGTCTGATAAGAGCTTTGGCCTGATCACGGGCCGG
TCCATGGGGGTCTCCCTCAAGGAGATCCCTGCATCTGCAGGCGAGTGGTGGCGGAAGCCCATGACTGCGCCCTACGACCG
CGTCCTTAGCGGCATTGTCGAGCTGCGCGGGCTCTTTGTACGTCTCTGTCCCGATCCCGAACCTCTCTCGATCCTGCTAA
CCGGTCGGCCGAGCAGCTCAACGCGATGGAGCAGCGAAAGAACGTCGAAGACACCCTGTCAGCCATCGCCCAATGGCACT
CGCAGGCCTACCAGACTCTGGAGCAGACCCGCAACGCCCGGTGTCTCCCAGACAACTCGCCGTCCGCCCAGTACATCCCT
CTGCTGTGCTTCTACCTGGACCATAGCATCATGGTGCTCAACGCCCAGGCTCTGCGCGATATGGTGGCCATTGACCAGAC
TGGCGGCTCGCCCGAGCTGATGGAGCTGTCCGCAAAGACCTTTACCGTGGCCAGCCGGCTGCTCGAAACCACGCTGCACA
ACGAGGTCCTCCAAGAATTCAAGGTCGGCTTTCACAACAACCAGCTGATCATGGTCTGCCATGCGGCCACTGAGATCCTC
GGCGTGAGTGCTTCGTCTTCTTGTTTGCAGGTCCTTCCTCTGCTGACACCGCCGCAGGCCATACAGCGCACCGGACTGTC
GCTCGACCAAGTAGCACAGGCTGCAGCACAGGTCCGTGCCATTCCCGGCCATCTCGATAAAGTTGCGGCCATGCTGCCAG
CCACATCGGCGACACATTTGTACGCCAGCCTCTCTAGATTTTTTGTCAGCCAGCTGGATCGCGTGGTGCGCAATACCGAT
ACAATAGGCCAAGACGAGCGCGGCGAGCATGACCAGGATTCGCTTCTGGCCGACTGGTGGAAGACCGTGGACGGCGGTCT
GCTGGACACCACGACGTGGATGGATCTGGGCTTTCTGAGTTCAGATCAGCATGGGATTAGTCAGGAATGGTCCATGTTCC
CATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62