GenePrediction:GLEAN_6386 Details

Name: GLEAN_6386
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:441988..439962 (- strand)
Length: 2027
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:441988..441909 (- strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_144:441847..441486 (- strand)
Length: 362
Type: CDS
Source: GLEAN
Position: GCSC_144:441435..441266 (- strand)
Length: 170
Type: CDS
Source: GLEAN
Position: GCSC_144:441204..441111 (- strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_144:441045..440721 (- strand)
Length: 325
Type: CDS
Source: GLEAN
Position: GCSC_144:440639..440454 (- strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_144:440327..440151 (- strand)
Length: 177
Type: CDS
Source: GLEAN
Position: GCSC_144:440097..439962 (- strand)
Length: 136
>GLEAN_6386 class=GenePrediction position=GCSC_144:441988..439962 (- strand)
ATGTCTTTCTCTGCTGGGAAGTCGGTCGATTGGCCGAATTCGACCACGGAGAACGAGGACGAAAAGTTTACCAACGAACT
GTAATGTTGGCTCTCTGTTTAGCGAGTCGTCCTGGTGACAACACTGACAATCGGGCCATAGGAGACGTGAAAAGTCCAGC
GCCGAAGATGTCGAGGCCTCTGTCCCGGTACCGGGTCACACGATATCGAGCCAGCTAGAATCCCAAGAAGTGTACCAGTT
GAGGGATGTCACCACCGCCAATGGCCAAGTCGAGACATACAAGATTGTGGTTTTTTCTCCAAACGACAAGGCGAACCCAA
AGAACTGGTCAAAGGCACGTAGATGGCTCATCACCATGACCTTGAGCTTGGTGTGCTTCTCGGTAGCATTCTCTTCAGCC
GTTGTCACCCCCGGGATCGCAGGCGTGGCCGAATCTTTCCATGTCTCGTCAGAGGTTGCCCTACTTTCTGTCACGCTCTT
CGTCATTGGCTTCGGAATCGGACGTGAGTATCAATCTTCCGATACGAATTGGCTATCATTGACCCTGTCGCAGCTCTGGT
CTTCAGCCCACTTTCCGAACTTTATGGACGGTGGATCATCTATGTGGCGACATTTGGCTTTGCCGTCATCTTCATTATAC
CATGTGCCGTGGCCAAGAACATCGAGACATTGCTATTATGCCGTGCGATTGGCGGCATTGCAATCAGCGTGCCCGTGGCC
AATGTAAGTTGATAGACTTGCAGGTCTATCCAAATGAACGGCTTTTAACAGATACTACACACAGATTGGTGGCAGTCTTG
CAGACATGTGGAAGCCTGAAGAGCGTGGCATCCCGATGGCATCATTTAGTGCTGCTCCCTTTCTGGGACCCATCATGGGT
ATGTTTGTGCCTCCATCCCTTTACGGCTGTGTATCAAGGGCTGAGGGCTGACAATGCACAAAGGTCCCATGATCGGCGGC
TTCGTTTACGAGAACATTGGCTGGCGCTGGCTGTACTGGCTCCAGCTCATCCTCTGCGGCACATTTTTTGTCGCCATCTT
GCTCTTCGTCCCCGAAACGTATGCGCCTGTCATTCTCGAGACGCGGGCGAAGAAGCTACGGAAGCAAACCGGGGACCACA
GCTACAAGGGAGAGCATGAGCTTCTTCGCAGATCATTCAAAAATATCGCCCGGGTTCATCTTGCCCGGCCTCTGCTATTG
CTGTTCACCGAACCGATCGTCACCCTGTTCGCTATCTATGCAGCTATTCTCTACGGAATCCTATACATGTTCTTCGTTGC
GTACGCTTTACAACACCACTTCCTGGGAGTACTGTGCTTCTTTTTGGCAAACGGCTAACAGACATACAGATATCCTATTG
TCTTTGAGGAGGGAAAAGGGTACTCAGCCGGGATTTCAGGCCTGATGTTCCTCCCCATTACTGGTGGCATCATCTTAGGC
CTTCTCGGAGCCCCTATGGTGAATCGTCAATACATCCGCAAGCGGTCAAAATACACAGGACTTCCTCCACCAGAGCTGAG
ACTGCTCCCCATGATGTGGAGTTGTTGGTTTATACCTGTCGGCATCTTTATTGTAGGCGCTCTGCTTCCCCGTTATATAC
GTCATCGCGAATTCTGACCAGCCTAACCTCAGTTTGCATGGACGTCTTATGACAACATCAGTTGGGTTGGGCCTTGTCTT
GCTGGCTTTCCCATTGGTGTCGGGTTCGTTTTCCTGTACAACAGCTTTAACAATTACATCGTCGATGCCTACCAGCACAC
TGCAGCTTCTGCCTTGGCTGCAAAAACCCTCCTTCGGTCCATCTGGGGCGGTTCCACCGTTTTGTTCACTACTCAGATGT
ACGTTGTCCAGTTTTCAGAACCCTTTAACGTCTGCTGATATGTTTGTACAGGTACCATAACCTCAACCCCCGATGGGCAT
CAAGTTTGCTGGCATTCCTTGCTCTTGCTTGCTGTGCCATTCCCTTCACTTTCTACCAGTTTGGGGCCGCCATCCGCAAG
CATTCCAAGTATGCCTATTCGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62