GenePrediction:GLEAN_6388 Details

Name: GLEAN_6388
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:435589..432558 (- strand)
Length: 3032
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:435589..435410 (- strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_144:435337..435160 (- strand)
Length: 178
Type: CDS
Source: GLEAN
Position: GCSC_144:435003..433962 (- strand)
Length: 1042
Type: CDS
Source: GLEAN
Position: GCSC_144:433668..432558 (- strand)
Length: 1111
>GLEAN_6388 class=GenePrediction position=GCSC_144:435589..432558 (- strand)
ATGGCGTCTCTTCGCACTGACAGTGTTTGGAACGAGGCAGGTCTGGACGTCGCCCGTTTCGAAGCCTATGCAAAGCTGCT
ATGTCTGCGGAACGGTGGGCAGGTTGAAGAGACGAGCATGTACGTTGATCTAAATAACGATGACGATGACATAATCAACG
ACCAGGTCGACATCTCCTCTGTCAAGGCTGCAACGATCTCTAGCTATGACCAGGAAAGGCTCAAATGAGCCTTTCTCGAC
CGGTTGTCAGAGCTCGCGTCTGCCGAGAAGGGCGGCAAACAGGTTGCTTGCTGCATGATGGTGGAGTGGCCTGATCATGT
CGACGTGCTCGTGGCGAAGAATAAGGCATTTGCGGAAAATGAACCAGGCATTCCCATGCTGCAAGAGCTTGCGTCAGCCC
TGCGAGAAATCAGCAAGTTCGATATGCACGGTTTGTTTTCTTTCTCCGCGTCGCTCTAGTTATCTCATAAACTGACGGCA
GGTATAGACCTTACGTTTGTTGACGACAGTCGACTACGGCTGTGGAAAACCGTATTGCAATTGTACCGAACCAGAATCCT
GTCCTATGCAAAAATCACTCTTACAGTGCTGAACACCATCATGCCGGCAACCACCACTGGCGAGTCAGCCCAGTTGTCTG
ACAACTACCGTGATCTTACAACAACCCTGCGGCTATTCCACCGATTGGTGACCAATGCCGAATACCTGGACACACTCGAG
GGTTGGGACGAGGCTGTCAGGATTGCATCGAAAGTACTCACGCAGTGCTCTGAATTAGACACGATTGCTAACCCCAACAC
TGCCGAGAAACTTGCAAATGCCTTAGGCTATCTGTCCCGTCCGCTAACATGTTATAATACGTTTATCCGCGCGGCACAGC
GCATGTCCAGCTTTGAAAGCGTCGAAATTCTACCTGTCTCAACCACAGGTCTGGGCGGATCTGATGCACGGCGAAAGAAA
AGGAAACCCGTACCTGCAGAGGTCTGGACGGCTGGCAAGGTTTTCGAAGCACTGAGCCTGCCCTTGAACGATACGACGGC
CGAACGGGTTCTTGGCAATGGCACGAAACGCCAGACCTGGACCAGAAACAAGCTCATCCAGAGGTACACTTCCCACAAAA
CTTTGCCTCCGACAGAGGTTCACGCCGAAGTCCAGATCCTGTTGGCAGCACAACGTCACAACTGTATTGGTGCACGCATC
GTTCCTTACATTGGCTGCAGCAAGCGCAGCTGTCTGCTTTGCACCGAGTTTGTCCAGGCACTCGGCCCTTACGCGACAAG
AGGCTGTCACGGAAAGCTGTACAGCCGCTGGACTGTGCCCCCTGTTTCGTGGATGACAGGTCCCCAGCGCCAGAGCCTGG
CACGGAGTCTCCACCATATGGAAGAGACCATGAAGCAGAGACTCTTACATCCCGCCATGTCGGACCGCCCGCTGCTGCAT
GTGCCCGAGTCAACAATCGGCGGGTCTTCCATGGCCACAATCAAGATACAGACGACCAGGCAGGGCTCTGTTGCCCAGCT
CATCGAACAGCGTCTCTCGGACCAGCTTGAAGATGCTATCCATCGCTGGTTTGAAAGGAACAGTAGTGACCGTGATGATG
CAGATACTTTTGATCATGTCGAGTCGAGGTAGGTTTGATGCCATCCGCGCGAGTTAAAGCCATCTAACGCACGGACAGCG
AAACCATTCCTGAAGGCATGAACGTAAACATGGCTCCCATGCAAGAAGTGGAGGGGCTGGAAGGTGATGCTTGGCACAAA
TGTGATATTTGCAGACTTGATACACGTTCTCACTGCACGTTCTGCGGACGCGACTGGTTCTGTGGAAGGAGTTGCCAAGA
TAGAATGACCTATCGTCATCTGGTGAAATGCTCGGCGCGACCCGTCACGACTGCTGATATTCTCTTCAACGCTGTCTCAA
GCGATGTGATACCAGAGGATCCCGAAACCCGCGAAGACTTTGGCATGGACCGCCTGAGTCACCGGCGTGAGGAGAGCCAT
CTGCTCGGCTTGTACCAGGGCCTTTGTCATTTGAACGTGGGGCCTACTGATCTGGACGAGTGGCGACGGACGGGCGTCCT
TGTAGACAAAATCATCGAAAAATTTGAGACCATACCCGAGGATTGTCGGGGCCTCTACTTCCCCTGGTTTGTTCGAAACA
AGCATATTCTCGATCCGACCGTGCCTCTTGTGTCGCGGGAAAAGAGGGAAGAGGAGGCTGTCTGGCAGGCTATTGTGAGC
GCCCAGCAACGTCTCGAGCCGCCATACCGCGACATGGACTGGCGGAAGATGGAGCCACTGTCGCTGAGGTATTGTTTTTT
ATTTTATGCGCTTTCACTCGACGGCTGCCATCCAAACCCCAACGCGCATTACGACGATATGTGGTATGATTTTGGCTTTG
CCGTCTGCGGTCACAACTTTGCAGAAATGCAGTTGTGCACCCTATATGGCCAGCTTTTTGGCGGGGATAAAGCCCAGCGA
GATTATGAGAAGAGTCTGGGATGTGGCAGGTTGTTTGGAGGCAGTAGCGACCATCAGCAGCGCTTATGTCCCTTTCTCGA
ATTCTGGAAGGCGTACGAAGACGGTACGCTACCGGAGCTTTTTGATGGCTACGACCTAGGGTATCAGCTGGACAGGTTCC
ACCATGCGAGGCTTTTCCTCGCTGCCAGGCCAGACATGTCCGGCTGCGTTCGCCCGCCTGTTTGGGGATTGCGCCATCTT
CTGGCCCTCGACGATGCGTCGGCAGAGTCTGCGCTGCGTTTTGGTGGCGCCTATCCGCTAATCGAGGCCGCGATTGAACA
GTTTGGCTTCCAGCCCAGGCTGGATGCTCGGGCCAAGGTGGAGCTTAAGAGGTTCTACGGGAGCCTGCTCGAAAAAAGCG
ATATTCTGGTAGTGCAAGAGGCCATGGAGACAGGCCAGTTGTTGGACCATGCGCTTGACCTCTTGGGGAGCAACGGGGTA
GATGAGAGCGTGCGAAACATTCTCAAACGCATGAAATCCGAGGAGAAGAAGAAGATTACGAGGGACACATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62