GenePrediction:GLEAN_6389 Details

Name: GLEAN_6389
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:430052..425342 (- strand)
Length: 4711
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:430052..429631 (- strand)
Length: 422
Type: CDS
Source: GLEAN
Position: GCSC_144:429570..429474 (- strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_144:429420..429308 (- strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_144:429239..428281 (- strand)
Length: 959
Type: CDS
Source: GLEAN
Position: GCSC_144:428009..427762 (- strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_144:427627..425342 (- strand)
Length: 2286
>GLEAN_6389 class=GenePrediction position=GCSC_144:430052..425342 (- strand)
ATGACATCCGGCTACCGTCAGCCTAGCAGAGATCCCGGGCTGAGACCCGCGGACAAGGACGGCGGTCGTACCTATGTGCA
AAACAAGGCGGTGGCCGATGAGCCGACCGGCGACTTTGCCGCCATCGACCCGCACTCGGGCGTCAAGCGCGGGCTCAAGA
CGCGCCACCTCAGCATGATGGCGCTCGCAGGCATCATCGGGCCAGGCCTGCTGGTTGGCTCGGGCGGCGCACTGTCGGAC
GGCGGCCCAGCGGCGCTCGTCATCGGCTTCGGCGTCATCGGCATCATCGCTTTTAGTATTATGCAGAGCCTGGGCGAGCT
GACGACGCTGTACCCGTCGGGCGGCGCGTTCGTCTCGTTGGCAGACCGCTTCGTGGACAAGGCGTTTGGTGTCGCCGTCG
GCTGGAACTACTTTATCATCTGGTACGGTGTCTTTTTGTCTTTTATGTATATATGTCTTTTGCTCGCGTGCTGACGACGC
AGGCTTGCCGTGCTGGCCAACGAGTACAACACCATCACCAGCATCTTCACCCTCTGGAGCGACAAGGTCCCCATCTGGGG
GTACTTTCTGATGTTTTGGGTGAGCGAGTCTGCTGCAAAGTCCCGGTCTGGATGCTGACTGTGGGTCGACAGTTCGCCTT
CACGGCCTTCCAGCTACTCGGCGTAGAGGCGTTTGGCGAGGCCGAGTTCTGGCTTGCGCTGCTAAAACTCGGCAGCCTGG
TGGCCTACTTTTTGTTTTCCATCATGTCAGTCGGGGAAGATTCTACAGTTTGGCTGTCAGGTTTCTACGAATCGAGCTGA
CTAAGCAAAACAGTTATGTCGGCGGTGGCATCAAGAACGTGCCAGCGCTTGGCGGGAAGTATTGGCACGACCCGGGGGCG
CTACCGCACGGCTTCCGGGGTGTAGCGACGGTGTTTGTCTTCTGCTCGACCTTTTACGCCGGCGTGGAGTCAGTCGCGGT
GGCGGCAACGGAAACGAAGAATCCGGGCGTGGCCGTGCCGCTGGCGATCCGGCAGGTGTTCTGGCGCATCCTTTTCATCT
ACATGGGCTCGGCCATCTTCTTCGGCCTGACCTGTCCGTCGAATGCAAGCGGGCTGATCAACGGTGGCAACCGCGCGCTC
AAGTCGCCGATGACGATCGCGATTCAGACGGCTGGTTGGCACGGCGGCCAGCACCTCATCAACGCCTTCATCCTGGTCAC
GTGTCTGAGCGCGGTCAATTCGAGTATCTACATTGGCAGCCGAACGCTGCTGTTCATGGCTCAGGACGGCAAGGCGCCCC
GGCTCCTCGGCCGGACCAACAGCCGCGGTGTGCCCATCGCGGCCGTCCTCATGACCAATGCCTGCGGCGCTCTCAGCATG
ATGAACGTCTCGACCGGCGCCAGCTCGGCCTACTCGTACATTGTCAATCTCTCTGGCGTCAGCACCTTTCTCGTCTGGGG
CAGCATCTCCTTCACCCACATCCGATTCCGCGCTGCCTGGAAGGCCCAAGGCCACACTGCGGCCGAGCTGCCTTTCCGCT
CGTTTCTGTACCCATGGAACGCCTACTTCGGCCTTGGGGCCAACGCCTTCCTGGCCCTTGTTCAGGGATGGACGACTCTG
TCGCCGTTCAGAGCTGGGAAATTTGTGGACTCATACATCCTGCTGCCCCTGTTTGCCGTCATCTACGTTGTGTACAAGCT
GGTATTCCGGACCCGGTTCTGGCGAGCAGGCGAGGTCGACCTGGTGTCCGGCCGGCGGCGGGACGTGGAGGAAGACAAGG
AAATTGCGGAGGGTGCGCACGTTTCATTATGGACGAGGCTTTGGAACAACTTTTGAGGTTTTGTGTAATATGCTGGGACC
TGTGTAAGCTATGTACGTAGTAAATAGTGGCACGTGACTCACACGTGACGCTCAATCGATAGGAAGCATTTCTGGAACAG
CGCACATAGCATTAAGCTTCATAGTACATATACCTCTCGGCGGCAAAGCGAATGCAATTGCGACATGTGCCAGCCCAACA
AAACGGAACAGTGGAACGATTGCGCAAGCGAAAACTGAGGCAGGACAAGTTGAGCACGCTTCCCTAAGACTCGGCGCAGC
ATGGTTGCGGAAGCCTGGCGCAATGCTGTCGAGATCCTCATCGATGACGCTGCCGGTGGCAGGGACGAGTGCGGGCGGGC
GGAGGCTGTCTGTCAGTTCTCGCATCTCGTTTGCGGTATCGAGCGCAGAGCGGGGCGAGAGTGAGGTGGCGCCGGCAGCG
GCAGCGGAGCACCAGATGGAAGAGGAGATCGCAGAGATCAAAAGATACGAGGTAGGTTGGCCATGATGGCTGCAGACGGC
GACGGAAGCTGACAGGACAGGACTTTACAACCATAGGTATGCGTGCATCTTGATGCAGGGCGACAGGCAGAAAGACGGAC
GGACTAACGGACAGACTGGGTGCAGGATGCAGCTCGCGAGCAGCAGCGCCGCAAGACGCAGCGACAGCACAGCGCGACGC
TCTACGACAACGGGCAGGCCGGATGGCGATACCGGCTGTGGGAGTGGTATGACGCGGGACAGGGCTGGATTGTGGTGACG
TTGATCGGGGCGGCGATCGGGCTGAACGCGGCCTTTCTCAACATCGTGACGGAATGGCTGTCGGACATCAAGATGGGCTA
CTGCACGACGGCCTTTTACCTCAACGAGAGCTTCTGCTGCTGGGGCGCAGACAACGGCTGCGCAGACTGGCACCGCTGGA
CGGTGCTGGAGCCGGCCAACTACGTGCTGTACCTGGCGTTCGCGGTGGTGTTTGCGTGGACGTCGGCGACGCTGGTGCGG
TCGTTTGCGCCGTACGCAGCCGGATCAGGCATCTCGGAGATCAAGTGCATCATCGCCGGCTTCACGATGAAGGGCTTCCT
GGGCCCGTGGACGCTGGCGATCAAGTCAGTGGCACTGCCGCTGGCCATCGCGTCCGGGCTCTCGGTCGGCAAAGAGGGCC
CCAGCGTGCACTATGCCGTCTGCACCGGGGCCGTGATCTCGCGCTTCTTCGGCAAGTACCGACACAACGCATCCAAGACG
CGCGAGATCCTGTGCGCGTGCGCGGCAGCCGGCGTGGCCGTGGCCTTTGGCAGCCCCATTGGCGGCGTGCTCTTCTCGCT
CGAGGAGATGGCGACATACTTTCCGCTCAAGACGGTGTGGCGCAGCTACTTTTGCGCGCTCGTGGCCACGGCCGTGCTCG
CAGCCATGAACCCATTCCGCACCGGCCAGCTGGTCATGTTCCAGGTGCACTACGACCGGTCGTGGCACTTTTTCGAGACG
GCCTTTTACGTGCTGATCGGCGTGTTCGGCGGGCTCTACGGCGCCTTTGTCATCAAGTGGAACCTACGCGCTCAGGCCTT
TCGCAAAAAGTATCTGGCACGCCATGCCGTGCTGGAGGCCACGCTGCTGGCGGCTGCGACCGCCCTGGTCTGTTACCCCA
ACGTCTTTCTGCGCATCGACATGACGGAGAGCATGGAGATTCTCTTCCTCGAGTGCGAGGGTGCCGAGGACTATCAGGGC
CTCTGCGATGCACCCAACCGGGCCTGGAACATTGCCTCGCTCGTCGTGGCCACCGTGCTACGCATCCTGCTCGTCATCAT
CTCGTACGGCTGCAAGGTGCCGGCCGGCATCTTTGTACCGAGCATGGCCATCGGCGCCTCGTTTGGCCGCACTGTCGGCA
TCGTCGTCCAGGCCCTGCACGAGCGGTACCCAGCCAGCGTCTTCTTTGCGGCCTGCGAGCCCGACGTGCCGTGCATCACG
CCGGGCACGTATGCGTTCCTGGGCGCAGCCGCCGCGCTCAGCGGCATCATGCACCTGACCGTGTCGGTGGTCGTCATCAT
GTTTGAGCTCACTGGCGCACTGACGTACATCTTGCCGACAATGATCGTTGTGGGTGTGACCAAGGCTGCCAGTGACCTCT
TTGGCGGCGGTGGTGGTGGCATTGCCGACCGCATGATCTCCTTCAGCGGCTTCCCCTTCCTCGACAACAAGGAGGAGCAC
AACTTTGGCGTGTCGGTGGCCCAGGCCATGACGAGCGACGTTGTCGCCCTACCGGCTGCCGGCATGACCTTGGCGGCCGT
CGAGCAGCTGCTGGCCCGCGGCAAGTACCAGGGCTTTCCAGTCGTCGACGATGTCGAGACCCGCGTGCTGGCCGGCTATG
TTGGCCGCACCGAGCTGCGCTATGCCCTCGAGCGGCTGCGCAGCGGGTCCAGCGGCCCTGATCTGCACCCGGACACCCGC
TGTCACTTTCTACCTGAGGGTCCTGTTTCTCCCGACAGCACCACAGCCGACAGTGTCGATCTTGGCCGCTTCGTCGACCG
CACGCCCGTCACCGCACACCCACGGCTGCCGCTCGAGACCGTCATGGAGCTGTTCCAGAAGATCGGCCCACGCGTCATCC
TGATCGAGTATCGTGGCCGGCTGTCTGGCCTGGTCACCGTCAAGGATTGCCTCAAGTACCAATTTAAGGCCGAGGCTGCC
GAGCACGCCCGTGACGATGGCCACGCTGCCGATGCTGCCCAGGAACAGCTGTGGGCCGCTATGCGCTGGCTGGCCGTCTG
GCTGGCCGACCGCCTGCATAGCCTCTCGGGTGGCCGCATCCGGCTCGGCGGCAGCGACAGCTACGGCGAGCTGGACGGCC
GCAGAAGCTCGATCGTCTTTGACGGCACAGAAGGATTCGACGACGACGGCGTAGAGCTGGCAGACAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62