GenePrediction:GLEAN_638 Details

Name: GLEAN_638
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1131750..1132458 (+ strand)
Length: 709
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1131750..1131866 (+ strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_97:1131978..1132098 (+ strand)
Length: 121
Type: CDS
Source: GLEAN
Position: GCSC_97:1132157..1132458 (+ strand)
Length: 302
>GLEAN_638 class=GenePrediction position=GCSC_97:1131750..1132458 (+ strand)
ATGCTGGATTTTGTCAAAAAAGCGCTGCACTATCTGCACAATCTGGAGTGGAGCGAGCGACAGCAGCAGCACTGTGTCTT
CTGTCATCGTGAGGAGCTCCCCGAAGTGGTCTACGTGGTACGATGCGCCGGCCGGCCTTTTTCTTGTTTTTTTCCCGTTT
TTCCGTCTTTTTTTCCGTTTTCCGTTTTCTTTCTCTTTTACGTCTACTGACCAAGTCCTCCGACACAGGAAGATGGCGTG
TTTGCGATTGAGAACCGGCGGCTGGCTGGCGAGCAACACTGGCTGATCCTACCAGAAAAGCACGGCTGGCGCGATATCGA
GAACCTCACGGCCGAGGACCTGCCGCTACGTGAGTCGTGTCGGAGGGTAGCGAGAGAGCTGACGAGCTGACCGTCTGGGC
GCATTAGTGGAAGCCATGGAACGCATGAAGAAGCGTCTGCTTGCGAGCCGATGCCCCGACCTGTCGCCATCTACCGTCGT
CTCGGGCTTCCATCGAGGACGGCGGCGGCTGCTGGGCAACATCTACTATCCCGACATCGTGTCAATACACCACCTGCATC
TGCACGTCATCGTACGGCCCCGCCGGCTGCTGCGGCTGTTCAAATATCCAGCCTGGCTGCCGCTCATGTGGAAGTCCGAC
GACCGGGTGATGCAACACGTCCGCAAGCTGGCCGGGCCCGACAACGGACTAAGCAAGCCAGGACGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62