GenePrediction:GLEAN_6390 Details

Name: GLEAN_6390
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:425085..423439 (- strand)
Length: 1647
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:425085..425037 (- strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_144:424985..423439 (- strand)
Length: 1547
>GLEAN_6390 class=GenePrediction position=GCSC_144:425085..423439 (- strand)
ATGGACGCAAACGACTTCCGGCAAGCGGCCACGGCCACGATTGAGGAGAGTGAGTGAAACACGTGCTATGTGGACCACAC
GACAGACGCTGACTAAGCAGTCATCCAGTACTACGGCAGTCTGGGCGGCCGGCCGGTGGTGTCGACGGTCGAGCCAGGCT
ACCTGCGGCGGTTGCTGCCGGCGGCGGTGCCGGAGCAAGGGGAGCCATGGTCGGCGATCCAGGCAGACGTGGAGGACAAG
ATCGTGCCAGGGCTGACACACTGGCAGTCGCCCAACTTCTTTGCCTTTTTCCCATGTCCGTCGAGCTACCCGTCGATCCT
GGGCGAGCTATACTCGGCCACGTTTGCGGCGGCGGCCTTTAACTGGATCTGCAGCCCGGCCATCACGGAGCTGGAGACGG
TTGTGATGGACTGGCTGGTGCAGCTGCTCGGTCTGCCGGCCGACTTTGCGAGCACGGGGCCAACGGCCGGCGGTGGCGTC
ATCCATGGCACCGCGTCTGAAGCCGTGCTGACCATGATGACTGCTGCTGCCGACAAGTATCTGCGCGCCGTTCTGGCCGA
CGCGGTCGTCGGCTGCTCCGACGAAGCTGTCGAGGACCTCCGTGCCGACCGTCGTGGCCGCCTCGTGGCTCTCGGCAGCG
CTGCCGCCCACTCGTCCACCAAAAAGGCCGCCCGCATCCTCGGCCTGCGCTACCGCTCTGTGCCCGTCGCTCCGGCCGAC
GGCTATCGCATGACCGCCACAGCTCTCCGCCAGACCCTCGCCGACGTCCGCGCTGCCGGACTGGAACCCTTCTTCCTCAC
CGCCACCTTTGGCACCACCGACACCTGTGCCGTCGACGACTTTGCCGGCATCGCCGACGTCCTCGAACAGGACCGCCGGC
TGGCCCAACAACAGTCCCAGAAACAGACCCTCCCAGAGGTCTGGGTCCACGTCGATGCTGCCTATGCTGGATCGGCTCTC
GTGCTGCCTGACCAGCAGGCCGCCTTTGCCCCTGCCGCTGCCGGCACCGACATCCTCCGTCGCTTCCACAGCTTCAACTT
CAACATGCACAAGTGGCTGCTCACCAACTTTGACGCCTCCTGCGTCTTCGTTCGCCGCCGTCGCTGGCTCGTCGATGCCC
TCAGCGCCGATGCCCACTACTACCGCAACGATTACAGCGATGGCGGCTTAGTCACCGACTACCGCGACTGGCAGCTGCCC
CTCGGTCGTCGCTTCCGCAGCCTCAAAATCTGGTTCGTCCTCCGCACCTACGGTCGAGACGGCCTGCGTGCTTATATCAG
CCGCTCCATCCGCCTCGGCGAGCGCTTTGCTGCCGCACTGCCCCCTGATCTCTTCGATATCATCACCGGCCCCCGCTTCG
CCCTCACTGTCTTCCGCTGTGCCCCTCGTGACCCCGCCGAGGACCCCGCCGCCACCTCCGATCGCACCCGCCGCGTCTAC
GAGGCCGTCAACGCCGGCGGTCAGATCTGGGTCACCAGCACCAGCCTCGAGGGCAAGGGCGCGGCCATCCGCGTCATGAC
CGGAAACTACCTCACCGAGGAGAAACACGTTGACGGCGCCATCGCCATCTTCATTGCCGCCGCCCGTCAGGCTCTTGCTG
ACGAGGACAAAAAGCAAGCAGCCCACCAACCCGACCTCAAAATTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62