GenePrediction:GLEAN_6391 Details

Name: GLEAN_6391
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:417799..416570 (- strand)
Length: 1230
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:417799..417769 (- strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_144:417664..417618 (- strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_144:417498..417128 (- strand)
Length: 371
Type: CDS
Source: GLEAN
Position: GCSC_144:417053..416570 (- strand)
Length: 484
>GLEAN_6391 class=GenePrediction position=GCSC_144:417799..416570 (- strand)
ATGTCGTTCAGCCACTGCAGGTTCTACGAGGGTAGGTACCCTCCCTTAAGCCGTTGCATTGAGGGGGTTTTGCATTTGGG
TGTTCCTGTGCACAGGCACGGCCGTCGCCCTGACATCAGGCTGACCGTCTTGCAGAGAAATACCCAGAAATCGACAGCTA
TGTTATGGTCAACGTTCGCCAGGTAAGCGTCATCCGAAGGGGGGGCGTTTCTCGATAGGAGGGAAGAGGCGCAATATCAT
GACGTCGCGTGCGGGGCAGAGACAAGGGCCAGCCTGCTAACCGGCATCCGACGCGAAACAGATCGCCGACATGGGCGCGT
ACGTGAAGCTCCTCGAGTACGATGATATCGACGGCATGATCCTGCTCTCGGAGCTGTCGAGACGGCGAATTCGCAGTATC
CAGAAGCTCATTAGAGTGGGCCGGAACGAGTGCGTGGTGGTGCTAAGAGTGGACAAGGAGAAGGGTTACATCGATCTGTC
GAAGCGCCGGGTGTCGCCGGAAGACGTGAAGAAGTGCGAGGAGCGGTACAACAAGAGCAAGATGGTGCACTCGATCATGC
GGCATGTGGCCGAGAAGACGCAGACGGCCATCGAGGCTCTGTACGAGACGATCGGCTGGCCACTGAACAAGCAGTACGGT
CACTCGCTAGACGCATTCAAGCTTTCCATCACGTACGTACCATGGCCGGGACGTTTGTCCGCGCGTGCTTGCCAAGACGG
GATGATGGCTGATACAAGTGGCACAGGAACCCCGATGTGTGGAACGACATCACCTTCCCGAGTGAGGCCGTGGCCGAGGA
GCTCAAGTCGTACATTGGTAAGCGGTTAACACCACAGCCGACAAAAGTGCGTGCCGATGTGGAGGTCACCTGCTTCTCGT
ATGCGGGCATCGAGGCCATCAAGACGGCGCTAGCGACGGCCGAGGCCGAGAACACGGACGACAACAAGGTCAAGGTGCGG
CTAGTATCGCCGCCGCTGTACGTCCTGACGAACACGTGTCTGGAGAAGAACACGGGCATCAGCCGGTTGCAAAAGGCAAT
CGAGGACGTGCGGGCGAACATTGAGGCTGCCGGCGGCAAGCTCGTGGTCAAGATGGAGCCCAAGGCGGTCACGGAGAGCG
ACGACGCGGAGCTGCAGGCCCTCATGGAGAAGCGCGAGCGGGAGAACGCCGAGGTCAGCGGCGACGACAGTGCGAGCGAC
AGCGGCGACGACCTGCCCGAGATTGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62