GenePrediction:GLEAN_6392 Details

Name: GLEAN_6392
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:416046..415373 (- strand)
Length: 674
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:416046..415727 (- strand)
Length: 320
Type: CDS
Source: GLEAN
Position: GCSC_144:415664..415373 (- strand)
Length: 292
>GLEAN_6392 class=GenePrediction position=GCSC_144:416046..415373 (- strand)
ATGGCGCTGGGCTCGCTGTGGGCGCGGATCCGGAGAGCAGCAGCCCAAGGCAGCGCGGCATCTGTGTTCATGTCGTCCAG
GTCCGAATTCGGGTCCGGATTTCTGCGGCAGTTCAACTGGCGGCTGTTCGGCCTTGCGACCTGGCTGCCGGTGGCCGTCT
GGTTCAACAGTGCCGTCGTGGAGGTGACACGAATCGAGGGCCCGTCGATGCACCCGTTTCTCAACAGCCACTTTGGCGAG
TCGCTGGAGCGCGACTGGGTTCTGAACTGTAAGCTGTATGCCCAAGAGGGACTGCAGCGCGGCATGATTGTCTTTTTGAG
GTCGGTAGTGTCTTGAGCCCTGAGCCTTGGACCCTGAACTTCTTCTCTCTGACACCTCCCAGGAGCCCGGTGCACCCCGA
GGTGGTGTCGGTGAAGCGTGTCATCGGCCTCGAAGGAGACGTCGTGCAGACGCGCCGGCCATATCCGACAGCATACGTGC
GCGTGCCGGCTGGCCATGTCTGGGTGGAAGGCGACGCGGGCGAGGGCCGCAGCCTCGACAGCAATACATACGGCCCCGTC
TCCATCGGCCTGGTGACCGGCCGGCTCTCTCACATCCTACTGCCACTGAACAAGGCTGGCCTGGTGCGCTGGTGGGAACA
CCCACTGGAGGACCGAATAACGGCTACGTCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62