GenePrediction:GLEAN_6393 Details

Name: GLEAN_6393
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:414701..413542 (- strand)
Length: 1160
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:414701..414648 (- strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_144:414567..413542 (- strand)
Length: 1026
>GLEAN_6393 class=GenePrediction position=GCSC_144:414701..413542 (- strand)
ATGGTGACTGGCACCGGTGATAATGACTACGAGGGGCGGCCGCCGTACCTGCATGTGAGCCAATCTCTCTTCCTGACATC
GGCCTAACGGCCGGCGATGCAATCGATGCTGACGGTGGCGCCCCTGCCTGACAGTCCATGCTTGCCGGCGGCCTCGGCGG
GACCTGCGGCGACATGTTCATGCACTCGCTCGACACGGTCAAGACACGGCAGCAGGGCGACCCGCACATTCCGCCCAAAT
ACACCTCGCTCGGATCGTCGTACTACACCATCTTGCGGCAGGAAGGCATTCGACGCGGGCTGTACAGCGGCTGGCTCCCG
GCGCTGCTGGGGTCCTTTCCCGGCACGGTCATCTTCTTTGGCACGTACGAGTTCAGCAAGCGGCACATGATCGATGCCGG
CGTGACGCCCAACATTGCGTATCTGGTGGGCGGCTTCCTCGGCGACCTCGGCGCATCGGTCGTGTACGTGCCGTCCGAGG
TTCTCAAGACCCGGCTGCAGCTGCAGGGCCGCCACAACAACCCGTACTTCCACTCAGGCTACAACTACCACGGCATGACG
GATGCGGCTCGCACCATTGCCCGCATCGAGGGCCTGCCAGCCCTCTTTTACGGCTACAAGGCCACGCTCTTCCGCGATCT
GCCCTTCTCAGCCCTGCAGTTCATGTTCTGGGAGCAGGCCCAGAACGGGGCACGCCACTGGAAGCAGAGCCGTGACATCG
GCTTGCCGCTCGAGTTTCTGACGGGTGCCGGTGCTGGTGGTCTCGCTGGCGCCATCACCTGTCCCCTGGACGTGGTCAAG
ACCCGGCTGCAGACGCAAGTGAACCCGGAGGTGGCCACAACGACAACAACAACTTCAACCAACCAAACGGCGCCCAAGTC
CGGCAACACACCTCCACAGAAGCGTCTCATCTCGACGTCGTCGCCCTCCACCCATACGCCGCGTCCCGGTGCCGTCAGCC
TCAAGACGTCGTCGGTCTACACCGGCCTCAAGCTCATCTACCGCACCGAGGGCGTCGGCGGCTGGTTCCGCGGCATCGGC
CCCCGTGTAGTGTGGACGAGCATCCAGAGCGGCTGCATGCTGCTGCTGTACCAGACCATCCTGCGCAAGCTGGACGAGCT
GCTGCCACCGGGGCCGCGGCCAGAGCTGGACGTGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62