GenePrediction:GLEAN_63 Details

Name: GLEAN_63
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:419086..421455 (+ strand)
Length: 2370
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:419086..419563 (+ strand)
Length: 478
Type: CDS
Source: GLEAN
Position: GCSC_179:419807..420637 (+ strand)
Length: 831
Type: CDS
Source: GLEAN
Position: GCSC_179:420710..421455 (+ strand)
Length: 746
>GLEAN_63 class=GenePrediction position=GCSC_179:419086..421455 (+ strand)
ATGCCGTCCAGCAAAGGGAACGAGACCGGCCGCGAGGCCGGCAACACAGTACGCAAGACGGCGCCGCAGCCACTGGCTCT
GGCTGAGTCGGCGCTCATGGCGAGCGACCGCAGTCTTGCCGACGCATCTCTTCAGATCGACTCACCAGCCGAATACTCCA
TCCATTCTCGATCTCCCAGGTCGCCCAATTCGCCATTACGCTACAACGATAGGAGCGGCAGCCTGGTGCTGAGCCAGACC
CCCGTACCGGCAGGAAAGCCGCCTGTTCATCTCGCCGAGCTCATCAGCCAGCCGCTTGCCGACAGCGAAAGCAGCCACCA
TCCCTCTCTCTCGACCTCCACCAGCTCATCCCAGCTGCAGCAACCAGCACAGCCACCGCAACAGCCACCACAGCAACATC
AGCAAAAGCATTACGGGCACGGTCGACACAGGCAAAACGAGGACAAGACATCCAAGTCCAATTTCTTCTTCCACTTTGGT
AAATCGTCTAGATCGACGGAAAGACTTGTGTCCGCCAGCGGCGGCAGCGGTGGTGGGAGTGGCAGCGGTAGTGGCAGCGG
TAGTGGCAGCGGTAATAGCTGTATGCCCGACCCAAGAGATGACCTTGCGTCAAGAGGTGGGGACTCGTCCTCAAGCAGGA
CCGGAAAACATTCAGGTAAGCCTAACCATGCAGGTCCAGCACTCCTGGGAAGCCTCCACTCACGGCTTTGTGCCTAAACA
GATGCCGAGCCCACGCAAGCGGCCAACAGCGCTGAGCTTCCGACACGCTCGAACGCCTCCCTTGTCTCCTCTTCGACCGA
AGCCGAAATCAGTTCTTCCAACTCACGAAAGGGGAAGCCGAAATCGTTTGGGCGTCTAGGGCGGACACGATCCAACCGGG
ATAAGAACGGCAACATCATTCATTCCAACACGACCACGGCGACCAATACACCGGCCTCATCTATGCAAGACGACGCTTCG
ATGCGAATGGTCGAGCCGCCCGAGCGCGCCTATCAGCCTGCTGCCACCCTGAAGCCGGCAGCCGTGATGCCGCACGAGCC
GTCCCACAGGGAGGCTAAGGCCTCGAGGACGCGCAACCACTCGGCAGAACGGGTGCGTCCACGCGATGTTCCTAGCACAC
GGGACGGCCATCAAAACAAGCAAAATCAAACCCGCGAGCGTGAACATGTGCGGGCACAGCCGTCGTCCTCGCGGGAAACC
GGCGGCTACACGTTTTTCAGCGGATTGAAGAACAGCCGAGCTGCAGACATCTTCAGCAAGGGATTTTTCGGTAAGAGCAC
ACGGAGTGGGAGCACGACGGAGCGGGAGCCAGTCGTGGACGATGAGCACTACGTGCTCCGGGTGATCAACCGGCCGCTCG
TCGAGCAGACACGAATGACTCGCATCTCGAAACGGCTAGAGGATTCGCGTGATAAGACGGAGTTCTGGATGCCTGCTTTC
CCGTGGAGGGCCATTGACTACCTCAACTTCAAGGGGACCGACGTGGAAGGCCTCTACCGGGTTCCTGGAAGCGGGCCGCA
GATCAAGAAGTGGCAGCGGAAGTTTGACCAAGGTTCGTTAGTGTCTAGACGGCCGACATTGCTGGCAGAAAGGCTTCAGC
TGCTGACCGTGTGACGCTGTGCAGAGCATGACGTGGATCTTCTTTCGCAGGACGATCTGTACGACATCAACATTATCGGC
TCGATGCTAAAGGCCTGGCTACGGGAGCTGCCGGACGAGCTGTTTCCCAAGGCAGCACAGGAGAGAGTTGCACGCCAATG
TGCCGGGTCCGAGAGGGTGCCCCAGCTGCTGATTGACGAGCTGTCGGACCTGTCACCGTTCAACTACTACCTGCTCTTTG
CCATCACCTGCCACCTGAGCCTGCTATTGGCACATTCGGACAAGAACAAGATGGACTACCGGAATCTGTGCATCTGCTTC
CAGCCGTGCATGAAGATTGACGCGTTTTCGTTCAAGTTCCTAGTGTGCGACTGGCGAGACTGCTGGCAGGGATGCCGAAA
CGAGATGCGGTACATTGAGGAGGAGTACCGGATCTTCGGGCTGCCACCACCCATGGGCATCTCGACGCCACGGTCGCAGC
TTCCGCCAGGCAGCGACGGGTTGGCGCAGGAGCAGGTGGCCGACATGCGGCAGATCTCGTCGTCGGACAGCGACAGGCAG
CTCGACCAAGTCGACCAGCCCCCGTTGAGGAGGCCGCCCAATATGGAGACGGGCAGCGTGGCGTCGACCTCGACTATCTC
GACGACACTGACGATTGATAGTCAGCGGGCGGCAACGCCGCCAGGGCAGTCTGGAGAGATGCGAGGAGATGGACGGGGAC
AGATGCGGCCGCTGTCACCGATCAAGCCGCTCTCTCCTCTCGGCTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62