GenePrediction:GLEAN_6402 Details

Name: GLEAN_6402
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:368123..360005 (- strand)
Length: 8119
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:368123..362269 (- strand)
Length: 5855
Type: CDS
Source: GLEAN
Position: GCSC_144:362133..361921 (- strand)
Length: 213
Type: CDS
Source: GLEAN
Position: GCSC_144:361613..361447 (- strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_144:361384..360688 (- strand)
Length: 697
Type: CDS
Source: GLEAN
Position: GCSC_144:360344..360005 (- strand)
Length: 340
>GLEAN_6402 class=GenePrediction position=GCSC_144:368123..360005 (- strand)
ATGGCACCGAGTGCACCAAACGCTGAAGCGGAACTATGGCGGCAGCAAGTGGCGACCATGGTGGCCGCCGTTTCGAAGCT
TAACCTGCCCTCGACAGAAGAGTGGGACCTGAGCAGCCTGGGCGAATACGACGATGGAGACGGCACAGACGACGGTCTCC
ACGCCAGTAGCGGCACCGACGGCCAAGATGTATGGGACTTTATCTCGGACGGCGAGCTGGAAGAGCTCGGGCTGTTTGGC
GAGGACGTTGAATATGCAGGTGCAAGCGAAGAGACGAATGCCGAGGTGCCGTACAGCCCCAGCTGGCTGGCGACACGGTG
CCAGGCGGTGTCTCTACGAAGCCAGGCGTCGTCAGAGTCAGCAACAGCGCTACCGGCCGACGTTCTGCAGGTGCAGATCA
TGGACGTGCTGCAGTCATCACGGCCAGAAGAGGAGCTGCAGTCACAGCTGACGGACCTGGTGGGCTTTGACGACCTCGAC
TTTGTGATTGAGCTGCTCGCACACCGGGACGAAATAGTGCTGGCAGGCCTGACGGCGCTGGCGGCAGATCCTCTCCCGAC
GACGACAGACAATGGGGTGGTGATGGTGGAGGGCCAGCGGCTGCTCACAAAGGCGCAGAGACAGGAGCAGCTGCGGCAAA
AGGACTATGAGCACAAGACGGCAACACTGGCGTCGGCCTCGGCTGCGGAACCGCAGTACCCGCACGTGTACCGAGCATAC
AATGCGGGCAACACGCTCAGCTTCTCGGGCAAGCGGTACGCACTGCCACCGGGCACAACGACGCATGAGTTTGACAAATA
CACCGAGTACTCTCTGCCGGCCGGTCGCAAGGGGACGTTGGGGCCCGGACAGAGACTGCTCCCGATCTCGGAGCTGGACG
GACTCTGTCGTGGCACGTTCAAGGGCTACAGGACACTGAACCGGATGCAGAGCCTGGTGTATCCGGTGGCATACCAGACG
AGCGAGAACATGCTGATCTGTGCGCCGACGGGCGCGGGTAAAACAGACGCGGCGATGCTGACGATCCTACACACGATCGG
ACAATACTGCCTTCCAAACCCGAGCGAGGATGCGACGGTGAGCGACTTTGCGGTGGACACGGAGGACTTCAAGATTGTGT
ATGTGGCGCCGATGAAGGCGCTCGCGGCAGAGATTACGGAGAAGCTGGGCAAGCGGCTGGCATGGCTCGGAGTGCAGTGC
CGTGAATACACGGGTGACATGCACCTGACCAAGGCGGAGGTGGTGCGGACGCAAATTATCGTGACGACGCCGGAGAAGTG
GGACGTGGTGACGCGGCGGGGGACGGGCGACACGGAGCTGGTGCAAAAGGTGCGGCTTCTGATCATCGACGAGGTGCACA
TGCTGCACGACGAGCGCGGAGCGGTACTGGAGTCGCTGGTGGCGCGGACAGAGCGGCAGGTAGAAAGCACACAGTCGCTG
ATCCGGGTAGTGGGCCTCAGCGCGACGCTGCCGAACTATGTGGACGTGGCGGACTTCTTGAAGGTGAACAGATTCGCAGG
GCTGTTTTACTTTGACGCGTCGTTCCGACCGGTGCCTCTGGAGCAGCACTTTATCGGAGTGAAGGGCAAGGCGGGCAGCC
GGGAGAGCAAGGAGAACCTGGACGCGGTGGCGTTTGAAAAGGTACGGGAGATGTTGGAAGCTGGACACCAGGTGATGGTG
TTTGTGCACTCGCGACGGGACACGATGGCGACGGCGCGGATGCTGTTCGAAAAGGCGACCGAGGAGGGATGCGCGGAGCT
GTTGGACCCGAGCGGTCACCCACGATACGAGGCGGCAGTGGCATCGATCCGACAGTCCAAGGCACGGGAGATTAGAGAGC
TGCTAGGCAAGGGCCTAGGGATTCACCACGCAGGAATGGCACGAGCAGACCGCAACCTGATGGAGCGGCTGTTTGGCGAG
GGCGTGCTGCAGGTTCTCTGCTGTACGGCGACGCTGGCATGGGGTGTGAACCTGCCGGCGGCAGCGGTGGTGATCAAGGG
GACGCAGGTGTACAATGCAGCGGAGGGAAAGTTTGTGGACCTGGGTATCCTGGACGTGCTGCAGATCTTTGGCCGAGCCG
GACGGCCGCAGTTTGAGGACACGGGCATCGGGATGATCTGCACGACACACAACAAGCTGAACCACTACCTGACGGCGGTG
ACGGAGCAGCTGCCGATCGAGTCGCGGTTTTCGGCGAAGCTGGTGGACAACCTGAACGCCGAGATCGCGTTGGGGACAGT
GACATCGATCCCAGAGGCAGTGCAGTGGATCGGATACTCATACCTGTTTGTGCGGATGCGGCGCAACCCGATGGCGTACG
GGATTGACTGGGCAGAGCTGAGTCAGGACCCGATGCTGGTGCAGCGACGACGACAGCTGGCCGAACAGGCAGCACGGACG
CTGCAGCAGAGCCAGATGATCATCTTCAACGAGACGACGGAAGAGCTGCGCAGCAAAGACGTTGGCCGGATCGCGAGCCA
GTACTACATCCTGCACACGAGCATCCAGCTGTTCAACGCAATGATGCGACCACACGCGACTGAGGCAGACGTGCTGGAGA
TGGTGTCACGGTGCAGCGAATTTGACAATGTGCAATCACGCGACAGCGAAAGCAAGGAGCTGTACCGGCTGCGAGAGACA
GGGACGGCGTGTGACGTGGCGGCCGGGCTGGACACGCCGCAGGCGAAGACGAACATCCTGCTGCAGGCGTACGTGTCGCG
GGTGCAGCCCGAGGACTTTGCGCTCGGCAACGACCAGAACTACGTGGCCCAGCAGGCCGGCCGGATCATGCGAGCTCTGT
TTCTGATGGCTCTCAACCGGCGATGGGGCCATCAGTGTCACGTGATCCTGTCTCTGTGCAAGGCAGTGGAGCAGCGAGTG
TGGCCGTATGCACACCCGTTGCGGCAGTTTGAGCAGCAGCAACGAATCCCCAAGGCAGTGCTGGCAGTGTTGGACTCGAA
GCCGTTGACGACGACGTCGATCGGGGCGCTGCGCGACATGGAGGCGGGTGAGCTGGGCAGCCTGGTGCACAACCAGGCAG
CTGGCAGCAAGCTAGCACGAGTGTTGCGCAGCTTCCCGACGCTGGCAGTAGAGGCGACGATTGCGCCGCTGAACCGAGAC
GTGTTGCGGGTGCGTCTGGTGCTGCAGGCCGACTTCCGGTGGGACGAACAGATGCACGGGTCGTCAGAGGCATACTACGT
GTGGGTAGAACACTCGGAGACGGCGCAGATGTACCATCACGAGTACTTCATTCTCAGCCGACGGCGGCTGCACGAGGCAC
ACGAGCTGAGCTTCACGATCCCGCTGGCCGAGCCACTACCATCGCAGATCTACGTGCGAGCCGTATCGGACCGGTGGCTA
GGGGCCGAGACGGTGACACCGGTGTCATTTCAGCATCTGATCCGGCCAGACACTGAGAGCGTGTACACGGAGCTGTTGGC
GCTACAGCCGCTGCCCATCTCAGCGCTGGCGAACCCGGTGTTGGAGGCGATCTACGCGGAGCGATTCCGGTTCTTCAACC
CGATGCAGACGCAGATCTTCCACACGCTGTACCACAGCTCGGCCAACGTGCTGTTAGGATCGCCGACAGGCAGCGGCAAG
ACGGTGGCGGCCGAGCTGGCGATGTGGTGGGCGTTCCGCGAGCGACCGGGCAGCAAGGTGGTGTACATTGCGCCGATGAA
GGCGCTGGTGCGCGAGCGGATCAAAGATTGGGGGCGACGGCTGGCCGGACCGGCCGGACTGCGGCTGGTGGAGCTGACGG
GTGACAACACACCAGACACGCGGACGATCGGCGAGGCGGATGTGATCGTGACGACACCAGAGAAGTGGGACGGCATCTCG
CGTAGCTGGCAGACACGTGGATACGTGCGCAAGGTCAGCCTGGTGATCATCGACGAGATTCACCTGCTGGCAGGCGACCG
AGGGCCGATCCTGGAGATCATCGTGTCGCGGATGAACTACATTGGGGCGGCCACGGGCAGCTCGGTGCGGCTGCTGGGAA
TGTCGACGGCGTGTGCCAACGCGACCGACCTGGCCAGCTGGCTGGGGGTGCAGCAGAGCCGAGGGGCGCTGTTCAACTTC
CGGCACTCGGTGCGGCCGGTACCGCTAGAGCTGTACATTGACGGGTTTCCAGACGTGCGGGGATTCAGTCCGCTGATGCA
GTCGATGAACCGGCCGACATTCCTGGCGATCAAGAACCACAGCCCGGACAAGCCGGTGATTGTGTTTGTGCCATCGCGAC
GACAGACACGACTGACGGCCAAGGACCTGGTCAGCCTGTGTGGGATGGAGGACAACCCGCGACGGTTCCTGCGGGTGGAC
AGCGAGGACGAGCTGCAGACACAGCTGGCACGGGTGCAGGACGAGGCGCTGCGCGAAGCACTGGCCTTTGGCATCGGGCT
GCACCACGCCGGGCTAGTCGAGTCAGACCGGGCGTTGTCGGAAGAGCTGTTTTTGGCGGGCAAGATCCAGGTGCTGGTGG
CGACAAGCACGCTGGCCTGGGGCGTCAACCTGCCGGCACACCTGGTGGTGGTCAAGGGCACGCAGTTCTTCGACGCCAAG
ACAGAGGCCTACAAGGACATGGACCTGACGGACGTGCTGCAGATGCTGGGCCGAGCTGGACGGCCGCAGTTCGATACGAC
GGGCGTGGCGCGGATCCTGACACAGGCGAGCAAGAAGGACTTTTACAAGCACTTTCTGCACACGGGCTTCCCGGTCGAGT
CGTCGCTGCATACGGTGCTGGACAACCATCTGTGCGCCGAGGTGGCGGCCGAGACGATTGTCAGCAAGCAGGACGCGCTG
GATTACCTGACCTGGACCTTTTTCTTCCGGCGGCTACACAAGAACCCGTCGTATTATGGGTTGGAGGTAGGGGGAGACGA
TGTTGAGGACGAGGATGCAGTTCGAGAGACGACAGCTACAGACTCCCTCTCGGCACAGCGACGGGCCAACACGTTCATGG
TCGAGATGGTGGACCGGGCGATGCACGATCTCGAGACGTCGCAGTGTGTGCGGCTGTATCCCAACGGCGACGTGGATCCG
ACGGCACTGGGTCGCATCATGAGCTACTACTACCTATCGCATCGGACGATCCGCTATCTGGCACGCCACGCGAAGCCGAA
GGCCGGCCTGGCCGACGTGCTCGCCTGGATGTGTCACGCGGCCGAGTACGACGAGCTGCCGGTGCGCCACAACGAGGACC
TGATCAACGCCCAGCTGACGGCACCGGCCTTTGGGCTGCCCTTTGCGGCCACGGCCTTTGGGCTGCCGCTGTGGGATCCA
CACGTCAAGGCGTTTCTGCTGCTGCAGGCCCACATGGCCCGGCTGGAGCTGCCGATTGCCGACTATGTCGGCGACCAGAC
GAGCGTGTTGGACCAGGCCGTACGCATCGTGCAGGCAGCCATTGACGTGCTAGCCGAGCTGAACCTGTTGTCGAGCTGTC
TGGCGATGGTGGCGCTGCTGCAGGGAATCAAGAGTGCAGTGTGGCCGACAGGAGAGGTGGTGGAGATATTGCCGGGGGTA
GAGATGAGGGGGAACGTCGACAGAGATCGAGACCGAGATCGAGACCGACACACAACTCTTCTACAGATTGCCCAGATGAA
CGAGCCCCAGCGGAAACAGCTGGCCCGCTCGCTCGGCGTGCCGGCCAGCCAGCAGGTCCGCTTCCTACGGGCGGCCACGT
TGCTGCCCAACCTACAGGTGGCCATCGGTCCGGTCACGACGACGTCCGTCACCGTACAGCTACGGCGGGCCAACGCACTA
ACCAGCCGCGAGGGCCGCATGTTTGCACCACGCTTCCCGAAACCGCAGACGGAGGGCTACTTTGTGTTTGTGGGGAATCT
GGCAAGCGACGAGGTGTATGCGGTAAAAAGAGTAGGCTGGGGGTTGGTGGGTGGAGGAGAAGGAGGACAGGGTGAACAAG
GTGGAAGAGGCGGGAGAGGGAAAGATCGGGGAAGCCGAGGAAGAGGCGGACGAGGAAGAGGAGGTGCAAGTGCAAGTGCA
GACGGAAATCCTTCCGAAAAATTGCCTTTTGCCAAGGCCGTCGTCAAACTCCCACCGGCTGCTGCAAAGGCTGGTCGTGT
CGATGTGCTCGTCGTCAGCGATGGCTATGTCGGACTTGAACATCGGATCCTGGGCGTGGAGATTCCGCCAGCGCCGACGG
TCGACGGCGTGGAAAAGGGGAAGAAGGGGGAGGAGAATCAAGAGTAGAACAACGAGCGAGGCGAGGAAGAAAAAAAGAAC
GAGAAACGAGCGAAGCGAGGACAAAATGATTCGTACTGTATCCAAACAACACGTGCAGCCGATTACTAAGACGTCATTGC
AGTCCAGGGATCGTCTTCACATCAGCGAGACTGCCAGATGGCCGTGACAACATTGTCAAAGCTTCTTGTCTAGAAATACA
CTGCTAAAACCTGCCTTACACTAATCAGGTAAGCTCTGTAGGACAGAACCAGATTCACCGCGAATATAGTATCCTCCTTC
CTCTTACGAACAGATACAAGTTGCTAACAGAGACCAAAATGGCCAAGTTCACCCCTCGAACGCCAAGTCAGCTATGGCTT
CTGCGTTGGCGCCTGCTGACGAAGATGTGACCAGAAAGGTGGTTTACAAGGACACAGACACCTTTTTCGAGGTGATCAAT
GATGTCGATAGAGACTGCGACTGGCAGGTCTTCACAGGTCCGTTCTTTTATCAGCTATTAGTATCCACCAGCAGAAAGGG
ATAATAACCCATTGACCAGGCGTTACACAAAACGCCTTTGAGGAGATCAACCGCGAAAGGGAAGCCCGGGGTCGCAAGAT
CCGGTTTCGTTACTTCCCTGATGACGATCTCCTCCATGTTACAATCCCGACAGGTTTACACGAACGAGGTCATCTCAACC
TGTATAACGCGATAACTACACAAATGGGCCAAATGAGCCAACAAACTCATGAATCGTGGAATTGCAGTGGTGCTACCACT
TACGCGGGTAGGGTTGGCGCATCTTCGGGGGAAGGCGACTCAGGTGGCTACCCTGACAGTCGCCTAGCGGATTCCCAATG
GCCTACTATTGTCGTTGCGTCAGGAGTATCGCAATCATTTGGCGACCTCGAACGAACCATGCGATGGTGGTTCTCTGCCT
CCAACCACCGGGTTAAAATTGTATTATTGGTCAAGCTCCACCGCGATAATCGGACGATGGAGATCACAAAATACACCGAA
GGTCCGGCTGGCCCTCGATTTGGGGCCACGAACACTAGGTCCTCCACCAACAATGCAGCACTGGCGCCGTTTCCTCGCCA
AGCCATCAGGATAACGCAACAAAGAGGGAATGACAACTCCATCACTTACCACATCACTAGTGGGGCGTTGATGCTGGAGT
TCGCCCTTCGCTTTTTGCGGCAGCCCAACCCGGATTATCATGAGAGGGACATCCTCATTTCTGTCCGTGCATTGCGGTTC
ATCGCTAGAAAAGTCTGGCAAGAGCCTCCCTCTCATCACTAGGCATGTGGTGGTCATGCCATGCAATCAGGGGACGTCTT
GTATCTTGGTGTACAATCTTGCTATGGCACAATGTGCCGTGGCGTTAGTAGACGACGTCATCTCGGAGACTGCTCAGATA
TAGACGGCTAACAGCATACTACTCTTAGATGAAAGGTATCACAATCAACATCAGCCAAGTAGGGAAAACATTAACGAAGA
GAGCGGGAAACATTAACGAAGAGGGTGGCGGCGGCAAGGTCGCCAAGCGATCCACAGCAAGTCCTTTCGCAACATACACC
TGCTATTCTACTGCGACAGCAACAGCGACGACCAACGAGACAACACAACCGGGCTTGCGCTGGCCGCATGCTATACCCTC
CTCCGATTCACTACCGACGGCACCGGCAACGACCACACAACAGGCGGCGCCTGGTTACAACCAGCACCGGAAGGTGCACT
GCAAATTTTTTCTTACTTTGTCGAAGACTGGAACCGGGCGTACGTGGCCATGCGCTCGTACATGGACCGCCGGGCGGGAC
ACCATGTGTTGTTTCCTGCCGTGACGCCAAAGCTGGCGAGAGAGAGGATTGATTGCATAAAGCCACGCAATTTTGGTGCC
GTTTTCGCCATTGTTCTTCTCACCCTCCCCAAGGGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62