GenePrediction:GLEAN_6404 Details

Name: GLEAN_6404
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:357023..356122 (- strand)
Length: 902
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:357023..356986 (- strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_144:356806..356122 (- strand)
Length: 685
>GLEAN_6404 class=GenePrediction position=GCSC_144:357023..356122 (- strand)
ATGGCCTCTCCATCAGGACCGGCAACGCCGCTGCTCTAGTACGTGCATTTGCAGAAGGGTCCGTTCGCTGCTTCCCGTTG
CTTTGGCCATGTTGAGAGTCCTCCCATCCGTCTCTTTGTCTTTCTTTTTTTCCTTCCTTTTTTTTATTTTTTTTCCTTCT
TCCCTTTTTCTTCTTTCCTTCTTCTTTCGTCTCTCGTCCCCCGCTGACCGCCCGCAGCGCCTGCGTAGCCCACAACACGA
CCATCTTGGCCGAGTGCACGACGTCGGCAGCCAGCCAGACGTCGTCGCTCGCGTCGCTGATCCTGCCCAAGATCGAGCAC
CGCACGCCACAGAAGCTGACCTACACCCATGGCTCGCACCACATCCACTACATCGCCGAGGCGACGTCCGAGCACGCCGC
CGACCGCGACGGCCACCCCAGCTCGGCCGGCGGGCTGACCTTTCTCGTCATCGCTGAGGCAGCGCTCGGTCGCCGCGTGC
CCTTTGCCTTTCTGGCCGCGCTGCGCACGCGCTTCCTGGCTGACTTTCCGGCTGTTGCCACCGACTTTGCCGACCTGCCC
AACTACGGCTGCGCCTCGTTCAACGGCACGCTGCGCGCCATGATGGTCGAGCAGGGCAGTGCCGGTGTGACCGGCGGCGA
CGTCCTCACCGGCGTCCGCCGCGACATCGAAGACGTCCGCGGCATCATGGGTCGCAACATTGAGAGCTTGCTGGAGCGCG
GCGAGCGCATCGATCTGCTGGTCGACCAGACCGACCGCCTCGGCGGCAGCGCCCGCGAGTTCCGCGTTCGCAGCCGCGGC
CTCAAGCGCCAGATGTGGTGGAAGAACGTCAAGCTGATGGGCATGCTGGCCGCCGTCGCTGTGCTGCTGCTGCTGACCAT
TGTCGTGGCGGCCAAGAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62