GenePrediction:GLEAN_6406 Details

Name: GLEAN_6406
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:350761..348867 (- strand)
Length: 1895
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:350761..350449 (- strand)
Length: 313
Type: CDS
Source: GLEAN
Position: GCSC_144:350358..350293 (- strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_144:350225..350097 (- strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_144:350037..349571 (- strand)
Length: 467
Type: CDS
Source: GLEAN
Position: GCSC_144:349502..348867 (- strand)
Length: 636
>GLEAN_6406 class=GenePrediction position=GCSC_144:350761..348867 (- strand)
ATGCATTTCGACCTCGGAAACCACATTCGGACACGGACACGCAGTGCTCAATTTGAGAGAACTGTGATGAACATCGTCTC
TCTCGGAACGAACACCATCACAGATGATCGGCGGTCCCTTCGTCCGCTGCCTGCACCGAGAGCCTCCAGCCTTGCTTTTC
CTAAGGATATGGACAACGCCATTGCCATGGAACGCCATAAGATGCCAGACAGTGAGGGAGGTCCTCCAAAGCTTCGCCCA
GTCAGACCTATGAGCTACGACGAACTCTACTTCAAAGCTGGACTGTACGAGGAAGCGTTCAAGACTCAGAGCTGTTAGAT
GCTTCTTCTGATTTTCAGCCCTGGGGCTTCCGTAACGCTTTGTGCGCCAATTCTCGAACAGGAGGCTAACATTTTTTTAT
TAGCTACAAACGGCTCATCTGCTGCTCCCGCAGTCATTGCCCCACAACCCAAGGCATCTTCTCCGACTCGTAAGCTGTGC
ATATGCATATTGTTCCTCTGGCACTGCGGAGCAAGCTGCTAACATCCATTTTACAGCTGCCGCAAACGATGCGCGGAACA
TTGTCCGGCGGAAGCTGACGGGCTACGTTGGATTTGCCAACCTACCCAACCAATGGCACCGCAAGAGCGTCCGGAAAGGC
TTCAACTTCAACGTGATGGTTGTCGGTGAGTGGCACCGTCCTTGCCAACTTCTCGGTAAAGGGCCCTCTAACACGGTGTT
TTAGGCGAATCGGGACTGGGCAAGTCGACCCTCGTCAACACCTTGTTCAACACTTCGCTGTATCCCCCCAAGGAGCGTAA
GAGCCCCAGCCTGGAGATCATCCCCAAGACTGTGACGATCCAGTCTATTAGCGCCGACATTGAGGAGGCTGGCGTTCGCT
TGCGCCTGACAGTTGTCGACACTCCTGGCTTCGGCGACTTTGTTAACAACGACGAGTCGTGGCGTCCGATTGTCGACAAC
ATCGAGCAGCGGTTCGACGCCTATCTCGATGCCGAGAATAAGGTCAACCGCATGAACATTGTGGACAACCGTATCCACGC
TTGCGTTTTCTTCATTCAGCCCACAGGCCACTCGCTGAAGCCTCTCGACATTGAAGTGATGAAGCGCCTTCACACCAAGG
TCAACCTCATCCCGGTCATTGCCAAGTCTGATACTCTGACGGATGAGGAGATCACCGCATTCAAGCGCCGGGTACGTTTG
CTGTAGCTATTGGACGAAGGGGTATAGTGGTAGGATTGGCAAGCTGACCATGGTTCTAGATTCTGGCCGATATCCAGTAC
CACAAGGTGCAGATCTTTGAGGGGCCCCGCTACGAGCTCGACGACGAGGAGACGATCGCGGAGAACAACGAGATTCTTTC
AAAGGTCCCCTTCGCAGTTGTGGGTGCCACAAATGAGATCACCAATGCCGACGGACGTAAAGTGCGGGGCCGTCGTTACC
CATGGGGTGTCATTGAGGTGGACAACGAGGAGCACTGCGATTTCGTGAAGCTCCGGCAGATGCTCATCCGCACCCACATG
GAGGAGCTCAAGGAGAACACGAACAACATTCTCTACGAGAACTACCGCACGGACAAGCTGATCCAGATGGGAGTGTCACA
GGATCCTAGCGTGTTTAAGGAAGTGAACCCGGCCGTGAAGCAGGAGGAGGAGCGCGCGCTCCACGATCAGAAGCTCGCCA
AGATGGAAGCGGAGATGAAGCTTGTCTTTCAGCAGAAGGTTTCTGAGAAGGAATCCAAGCTCAAGCAGAGCGAGGAGGAA
CTCTATGCCCGGCACCGGGAGATGAAGGATCAACTGGACCGCCAACGTGCAGAGCTGGAGGAGAAGAAGTCCCGCCTCGA
GAGCGGACGGCCCCTGGAGAAGGAGGGCAAGCGGAAGGGGTTCTCTCTTCGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62