GenePrediction:GLEAN_6407 Details

Name: GLEAN_6407
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:345758..344434 (- strand)
Length: 1325
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:345758..345699 (- strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_144:345512..344909 (- strand)
Length: 604
Type: CDS
Source: GLEAN
Position: GCSC_144:344549..344434 (- strand)
Length: 116
>GLEAN_6407 class=GenePrediction position=GCSC_144:345758..344434 (- strand)
ATGAGTGACGCAACAGTAGCTGTCGAGGCTGCGCAGCCTGCTGTCGCGGCTGATGCTGCGGTGGTTGCAGTAGAGGAGAC
GAAGGAGGAGACGAGGGAAGAGGCGAAGGAAGATGCAAAGGAGGAGACGAAGGAAGAGACGAAGGAAGAGGCAAAGGAGG
AGACGAAGGAAGGGACGAAGGAAGAGGCAAAGGAAGAGACGAAGGAGGCAAAGGAGACGAAGGAGGGAGAGGCTTCGAAA
GACAAGGGCGCAAACAACCGCAAGTTTGACCCGAGCGTGCTGCCCGAGTCGGAAGATCATGTGGCCATTCAGACGCAGGT
GCACTTCTACTTCAGCGACAGCAACCTGCCGACGGACAAGTACCTGTGGGAGCTGACGGGCGGGTCGGAGAACAAGCCGG
TGGAGCTCAAGAAGATTTGCCAGTTTGGGCGGATGCGGCGCTTTAAGTCCTACGAGACGGTGGTGGCAGCGCTGGCGTCG
AGCAAGTTTGTCGTTGTTACCGGCGAGGCCGGCCAGGAGACGGTGGCGCGCAAGAACGCCTACAACGCGGACCGGCCGCG
CAGCAAGATCGACGCGGCCACGGTGTACGTCAAGGGTTTCGGCGACGAGGAGCCGTCGACGCAGTTTGACCTCGAGGCCT
TCTTCACCAAGCACGGCGCCGTCAACGCGGTGCGGCTACGCCGCACTGCCGACAACCTCTTCAAGGGCTCCGTCTTTGTC
GAGTTCCAGGACGCCGACCAGGCCGTCCGCTTCCTCGCGCTCGACCCCAAGCCGACGTGGCGGGACAGCGAGCTCAAGAT
CATGTCCAAAGCTGCCTACGTGGCCGAGAAGTCGCAGCTGATCCGCGAGGGTAAGATCGAGCCCAGCAACAACAGCGCCC
CGCGCTTCTTTGAGGGACGCACCCTGGGCGGCAACCGTCGCGGCGGCCGTGGCGCCGGCCACTCGGCCGACAAGGACGAC
TGGAAGAAGCGCCGCGACGAAGACCGCAAGAACGGCTTCCGCGGTGGTCGTGGCGGTCGTGGCGGCGGAGGCGGTCGTGG
TCGCGGTGGCCGTGGCAACTGGCAGAACAAGGACCGCACCAACGGGCACAATGGCCAGAAGAAGTGAGTTTTTTATCTTT
TCGTTTCTTTTCTTCTTTTCTTCTTTTCTTACTCTTCTTTATCTTCCTCTTTCTTTCCCCCGACACTAACCCCTTCAGTG
GCAAGCCAGAAATCCAGTCATCCACCGAAGCCAGTGCCAAGCGCAGCCGCGACGACGACGGCGCCAACGGCGCCAGCGAG
CCGCCCGCCAAGAAGATCGACAACAAGGCCGAGATTGCGGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62