GenePrediction:GLEAN_6409 Details

Name: GLEAN_6409
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:340457..337461 (- strand)
Length: 2997
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:340457..338719 (- strand)
Length: 1739
Type: CDS
Source: GLEAN
Position: GCSC_144:338658..337819 (- strand)
Length: 840
Type: CDS
Source: GLEAN
Position: GCSC_144:337560..337461 (- strand)
Length: 100
>GLEAN_6409 class=GenePrediction position=GCSC_144:340457..337461 (- strand)
ATGAACGACCGTCTGCAAGGGAAAAACGCCTCCTATGCACCCGGGCTCGACAGCCTCTCTGCCGGCCAGATCTCGTTGTC
CACACCCTCTGCCAATCTCGCGGGCGTCATGTCGGCTGCCCCCGTCTCTCGGCCTGGTGCGGGCGGCAAGAAGAAGTCCC
GGCGCAACGCCGACTCGTCGGCGCAAAAGCGACGCTGTGTCAGCACGGCCTGTGTTGCGTGTCGCAAGAGAAAGTCCAAG
TGCGACGGTGCACTGCCCAGCTGTGCTGCGTGCGCCAGCGTGTACTACACCGAGTGCGTCTACGATCCGAATTCGGACCA
CCGCCGCAAGGGCGTCTACCGCGAGAAGGTCGACAGCATGAAGGCCCAGAACTCGACGCTGCAGATCCTGATCGAGGCCA
TCCTCAACGCGGACGAGGAGGATGTCGCCGCGGTTGTGCACAGGATCCGCACGTGCGACAGTCTGGACGCCGTGGCCGAG
TCTCTCGTCATGGAGGACTTTGAGCAGAACGAGAGCCACGGCGGCCTGCTCGGCTCCGGCTCGGCCGACGCTTCCATGAT
GTGGTCCGGGAACCCTGTCGAGGGCGAGGTGGAGCTGGCGCGCAAGATGGGCGAGCTCCGACTCGAGAACGGCTCCGTGC
GCTTTATCGGCGGCACCTCGCATCTGATCTACGTCGGCGACCCGGCCGACGATGAGACAGGCTCTGCACTTACGGCCAGA
GACGCGCATGGCAGGGCGCTCGATGGCGGCCAGACCAGGCCCCAGCTCGAGCCGGCCTATGGCACGCGGGAAGAGGCGAT
TAACAGCTGGACCACGGTGACCAGCGACACGGCACTGATCGAGTTTCTCATGCAGATGTACTTCAACTGGCACTATACAT
ACTTCACCACCCTGTCCAAAGACTTGTTTTACGAAGACTTCTACCGCGGCCGGCCGAAGGTGCTTCCGCGCCGCACCGTC
CACTGCACCTCGCTGCTGGTGAACGCCATGCTCGCGCTCGGCTGCCACTTCACCAGCGTGCCCGGGGCCTTTGCCGAGCC
GGGCGACAGCCGCACAAAGGGCGACCACTTCTTCGCTGAGGCCAAGCGCCTGATCGTCGAGAACGACGAGTACGAGAAAC
CTAGGCTGGCCACTGTCCAGGCGCTGGCCCTGATGTCGGTGCGCGAGGCCGGCTGTGCTCGCGAGGCCAAGGGCTGGGTG
TACAGCGGCATGAGCTTCCGCATGGCCCAGGACATTGGCCTCAACCTGGACACCGGCGGCGGGCCAAACGCGGCCATGAG
CGCGGACGTTGATGGCCACAACGGCCGGATGGACGACGGCGAGATTGACGCCCGCCGCGTCACCTTCTGGGGCTGCTTCT
TGTTTGACAAGGCGTGGTCCAACTATCTCGGCCGTCTGCCGCAGCTGCCAAAGGGATCGTCCAGCGTGCCCAAGTACGAA
GTCTTGCCGAAGGAAGACTCGGAAATGTGGGCAGCCCTGACGGATTCCGGCTACGACGAGGCCACGCGCCAGCCATGCCG
CACCCGAGCTGCCGGCCTGAAGCTGTCGAAGCTCTGTGAGATCAGCAGCGACCTGCTCCTTTTTTTCTACCACCCGAACA
ACATTGGCCGGTCCTACAGCAAAGCCGTCGAGCTGAAGAAGCTCAGCGAACTGCACCGCCGTCTGGAAGACTGGCGGAAG
CAGCTGCCGAAGGAGTTTGAGCCGAAGGAGGGCCAGCTGCCGAATATGATTCTGACGCAGTAAGTGGTGCCTGTGGGCCG
AGTGCAGGGAGAGTGCTGACGGTCATATCTGTGCTTTAGCATGTTCTTCCACCTGCAGTACATCCACCTCTTCCGACCCT
TTCTCAAGTATGCGCCCGACGTGTCGCCCCTGCCGTCTCACGTGTCACCGCGTCGTATCTGCACTGTGAACGCCGGGGCG
ATCTCGAAGCTGATGCGACTGTACAAGAAGACGTACGACCTTCGGCAGATCTGCAACATTGCCGTGTACATGATCCACTC
GGCCTGCACCATCCACCTGCTCAACCTGCCGGAAAAGACGGCCAAGCGGGACATCATCCACGGCGTGAAGCAGCTCGAGG
AGATTGCGGAAGATTGGCTGTGTGGCCGTCGCACGCTTTGCATCATCAGCGTCCTGGCTCGAAAATGGGGCGTGGATCTG
CCGGAGGAGGCGGCCACCGTTCTGCAGCGGACCGACGAGAAGTACGGGACGTTCAATACCAGCGACGTGCCGTCGCCGAA
CCGTCCGATTCCTGCCCTGTCGCCACCGACCACTTCGGCCTCACCCCAGCTCGTCCAGGGCGCCGAAGCGGCGCCATCGG
TGCTCATACAGACCGCCGCAGCCCGGAACACTGAACGATCGTTTGCTTCTACCAGCTCGACCAGCCCCTACGGACAACTG
GCACAGACGTCGCAGCCGCCTGCCCACGGCATGTCCTACCTTGGCGTCACGTCCGACGGGTTATCGCCCCCGACTGCAAG
CATGGGCACGATGCGGCGTGTTCTCCCGATGGCACAGGCCGATAGCGATCTGCCCAATATGGGCGCTTGGTCCGTACCGT
CAACGATTCCGCAGACTATGCCGGGCTATGCACAGCCGACGGCGCCGGCCGTGTCCTCGCAGCAAATCAGCTCTCCCTTG
TTTGCCCTGGATGGACAAGATTGGCTTCTAAGAGAAAGTGCCAGCTGGCAACACAACTTTGAAACCTGGGGACTGAACCA
GCAACAACACCCTCGGTATCCGTCACCACAGGAACAGCAGCAGCAACAACAACAGCAACAGCACCTACAACAGCAACGGC
GACAACAACAACAGCAAGACCAACACTCCAACTACACGACGCAAGCAGCGGTCAGTCCAGCCAGCACGGGCAATGCCAGT
ACTCCCTTGTCTGACAGCTATGCGCTGTTCTGCGGTGCGCACGGCGTGGACTTTGATTTTCCGTTAGACGGCCTCGGCGG
ATCTGGTGCTAGTCTTGATAGACTAGGACTGGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62