GenePrediction:GLEAN_6410 Details

Name: GLEAN_6410
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:330599..329492 (- strand)
Length: 1108
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:330599..330347 (- strand)
Length: 253
Type: CDS
Source: GLEAN
Position: GCSC_144:330137..330095 (- strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_144:329954..329492 (- strand)
Length: 463
>GLEAN_6410 class=GenePrediction position=GCSC_144:330599..329492 (- strand)
ATGCCCATTTCCGCAACGGTTCCAGAATCACAGCCAGCAGCCTCCCGCTCTCGCGGCCGGGTGGCATGGCAGGCCCCAAA
GGCGACCGACAGTCCAGCCGGCGGCAGCAGTGACGACAGCAAGACTGCCGTGTCCGCGGCTCCAGAACCGACGCCCTTTC
GCCGTGGCCGGACATCTCGTCCCGAACTAGCTGTTGCGGAGCTGTTCCGGCGAGGTGACGACTTTAGCATTTGTGGCTTT
ACATCAGGATCCAGTGCGTTTCCGAACCAGTGCAGCATCGCTGTCGTGAATCGCTGTCGCGATAATCTTTTTCGCTCACT
GACAACCCGGGCTAGATGATGAATTTACCTGTGGCGGCTCCAGTTCCGTCTGTGCTATAGGTGACAGCGTCTTTGGCTGC
TGCACTACTACCGATGCGATAGATGATTGCTTATCGACCATGCCATTGTGTCGCCTCCACAGACGTCGACGATGACGCTG
ATTCCGACTCAATGACGCATACTTGGTAAGCTGCCTGTGTTTCGTCTTTCTATATTCCCCTACTCTGGCGGCTAACTCTT
GCTCAAGCACTGGCACGAGCAAGTCGGAATGCATCACCTTGGTGCAAACATATACTGCGGACAACGTTTGGTTTACTCAC
TATAGCTGTGGGCCCGAAGACCTCACCATCACGCTCGTTGCCCAAGCAGCATCTTCGCAAGTCTCGTCCTCCTCGGGGAC
CGGTCTCACCCAGCTGGACCCCACAACACGACACAGCACCACCTCCAACATCTTTGGCACGGCCACCCACAGCAGCACCA
CATCTGCCACAGGTGCTCACTCGACGAACAAGGCCGGCGATAAATCTTCAAGCGGTCTCAGCCCAGGCGCCATTGGCGGC
ATCTCCGTCGGTGCGTTTGTGCTCTTGGTTGCCCTGCTGGCCATGATCTGGCGGATGACCAAGAAGCGCCAGATGTCGAA
CATGGCGGCAGCGTCGCAGTCAGATCCATTTGGAGGCAGCGGAGGCGACTCCGGACTCAAGGGCGGACCCATCGCCGGCG
CCATGGCCATAGGAAAGACCGGTGGCGCCTACCGGCAGATTCAGCAGCAGCAACAGGACCAGATTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62