GenePrediction:GLEAN_6411 Details

Name: GLEAN_6411
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:328454..326024 (- strand)
Length: 2431
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:328454..328263 (- strand)
Length: 192
Type: CDS
Source: GLEAN
Position: GCSC_144:327414..326882 (- strand)
Length: 533
Type: CDS
Source: GLEAN
Position: GCSC_144:326828..326024 (- strand)
Length: 805
>GLEAN_6411 class=GenePrediction position=GCSC_144:328454..326024 (- strand)
ATGGCTCCCATCTCCGAAAGCACACAACCAGGTGGGACGCTCGACACGGCCAGCAAATTTCTCTTCTGGTTTTTCCTCTG
CGTGACGGTGGCCAGCGTCACAATCGCCATGGTCACTCTGCACCGTGGAAAGAAGCGCGAGCGGGTTCTGGCGAAGAGCG
ACATGGAGCAGGTGGTAGTGCAAGTCCCGCCGGTAAGTACACGAGAACGCAGATCTAGATCTTCTGTCCCTCGCACTAAT
TCGCCCCAACGAAGGCAGCAAAAAGTCGACTCGAGACCATCTAAGGCCAAGCCAACAGCAGCTTTTTTTTGTCGGCCTTT
TAGCCTTTTCTTGCCTCTTCAAGTTCGGCATAACAAAAAAGAAAGAAAAGAAGAAAAGAAGAAGTCTTATAAAAAAAAAA
AAAGAAAAAAAAAAGAAACAGAAGTCAGGAGTCGCGGGCTTTACAGATGATGTACTCCACACTGCAGCTGACGTGTATTT
GAGCAACGAAATGAACGTGGAGACAACATGATGCAGCTACTGTACGCCGTACGTGCCAGCAGACTTCCGGTGCAGGCCCC
CAGAAGTATGTCCTCCGCTAAAACTCTGCCGTGCACGAGACGGGCTGTTATTTCCTCGGCTTAATGTTTGCGGCGCCTTC
CGCGGATTTACGGCGTCTCTTAGGCCATTTCGGCCTCTGGCGCTAGCTTATCTTTACGTCACAAACTCACGGTCCTTCTG
GCTTTGGGCTCAAGTACATTTCTTAAAACGGTTCTGCTTTTCCCTTCCAAAAAGCCAGATATATCGAGGACTCGCTCTGA
GCAAGGAGTCTGGGAGCATTGGGGCCGGCCGTTACCCAGATAATCAAATAAAAATCAAACAATCGTTCTGCGCTGTTGGT
GCGAATGACTTCTTATTCTTCTCATGCAGAGGACACCTGCTTAAACTACCAAGCTCCTGCTTTGGCCCGGCCTTTCGCCC
CGGTGATCTTGCGTGGAGATGGGGGCTCAGAAAATCAGGACAGTCATGGGCTCTTTAACGACGGGCTGCCGCTGGCCCAG
CCACAGGAGAAGGGCGTGATGCCGCGATCGGGCGCGAGCACGGTCGAGTCGTCCAACGGGTTGCCGGACGTCGACGTCCG
CTTTCCTGAGGGCGGGGTGCAGGCCTGGCTCGTCGTCCTGGGCTCCTTCTCGGCCATGTTCTCGGTGTACGGGCTGATCA
ACACGGCGGCCGTGTTCGAGTCCTGGTTTTCGACGCACCAGCTGGCCGACTACTCGGCCTCGGCGATCGGCTGGATCTTC
AGCCTGTATCTCTTCTTCGTCTTCTTCGTCGGCATCCAGGTAGGCCCGCTCTTCGACCGATTTGGGCCGCGCCTGCTGGT
GGCCACCGGCAGCCTGCTGAACGTGACCAGCATCATGCTGCTGGGCCTGTGCACCAAGTACTACCAGATCCTGCTGTGCT
ACTCCGTGCTGGGCGGTCTCGGCGGTGCGCTACTCAACACGCCCGCTTATGGCTGCATCGCCCACTTTTTCGACGCGCGG
CGCGGCCTGGCCACCGGCATCGCCTCCCCACGTCGGGCGGTCTTGGCGGCATCGTCTTCCCCATCCTGCTGCAGCATCTA
TTGCCGCGGCTGGGCTTCGGCTGGAGCACCCGCATCCTCGGCTTCATCCTGCTGGCCCTCGCCGTGCCTGCGAACTTGTG
GCTGCGCACGCGGCTGCCGCTGTCTGGAGACGGTGACGGTGGCGACACGGATGCCACTGAAGTCGACCTCGCCGTCTCTG
ATGCCGCCAGCACTGGTGGTCGTCGTCGTTCTCGTCGTCGTCCCCGCGTCCAGTCAGTCTGGCCCGATTTCACCATCTTC
CGCGACAAGTGCTATGCCATCGCCACCGTCGGGGTCTTCTTCATGGAGTGGGGCATCTTCGTGCCCATCACATTTATCAT
CTCCTATGCCAGCGCCCACCACCAGGACGCCACCAAGGCCTACACCCTCCTATCCGTCCTCAACGCCGGTTCTGTGGTCG
GTCGCTTTCTGCCCGGCCTGCTGGCCGACAAGCTGGGCCGCTTCAACGTGATCATCGTCACCATCGCACTCTCATCCATC
ACCGTGTTCGGCATCTGGATGCCGACCGGCGACTCTCGCCCGACGCTGCTCGCCTTTTGCGTGCTCTTCGGCTTTGCCAG
CGGCAGCAACCTCGGCCTCATTGCCGTCTGTCTCGGCCAGTTGTGCGAGCCTAGCGAGTACGGTCGCTTCTTCTCGACCG
CCATGATGGTCGCCAGCTTCGGCACTCTCAGCAGCGTCCCCATCGGCGGTGCCCTGCTCAGCAGCAGCCTCGGCGAGAAT
GGCTGGAGGGCCCTGATCGCCTTTTCTGGCGGTTCGTACGCTATTGCTCTGGTTTGTTATGGTGCTGCGCGCGTCATGGC
TGTCGGCTGGGGCCTGAAGACCGTTTTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62