GenePrediction:GLEAN_6412 Details

Name: GLEAN_6412
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:325755..322153 (- strand)
Length: 3603
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:325755..324154 (- strand)
Length: 1602
Type: CDS
Source: GLEAN
Position: GCSC_144:323964..322153 (- strand)
Length: 1812
>GLEAN_6412 class=GenePrediction position=GCSC_144:325755..322153 (- strand)
ATGGCCGAACTGACGGCAGCCCCGGTGCTGTCGACACCGGCAGAAAACCTGTTTGAGGCGGCCGAGCCGCTGCCCGACTT
TGCGACGCTGCCCCGCCGAAGCGACGACGAGCTGCGGGAAGTCTACGAGATCAGCCGGACGGCACGCGAGATCCATGCGG
CCAAGCGGCGGCGGATAGCCCTACAGTTTCCGGACACGATGCTGGGCGACGCGCCGCGGGTGGTTGGGCTGCTGGGCGGG
GAGCTTGCGGCAGTGCAGCGTAGCGAAGACGAGCAAGACGAGAAAGAGGAAGCCAAAATCTACATCCTGGCCGACACGTC
CTACAGTGCATGCTGCGTTGACGAGGTGGCAGCTGAGCACGCTGACGCTGACGTGGTGGTGCACTACGGGCGGTCGTGTC
TGTCGCCGACGTCGCGGCTGCCGGTGATCTACGTCTTCACGCGCCATCCGCTGGATGAGGCGCAAGTGGTGGCCGCATTT
GTGCGCGAGTTTCCGGATCCGGCAGACGCTCGTCCAGTCATCTTGATGGCCGACGTGACGTACCAGGATCACGTGCCGGC
CGTGTACGCCGACCTGCAACGCCGGGGCTATGCACACGTGCTCTCGACAGCCGTGGTGCACAACCCAGTCGGCAGCCTGC
CCAACCGGACGATGATTGATGCGGACGGCCAGACGGTGGCTGACGAGGCTGTCCAGCTGCAGGACTGCGCCGTCTTCCAC
GTCTCGGCGCCGCCGACGTCGCTCCTGCTCGCGCTCGCCGCCAAGGTGCAGGCCTTTTTCGTCTATCCGACCGAGATGGA
CGGGTTGTCGGACGTGCTCTCGCCGGCGACACGCGGCATGCTCGGGCGGCGGTACGCCAAGGTGCTCCGAATGGCGACGG
CCGGCGTGATCGGCATCCTCGTCAACACACTCTCGGTCAGCAACTACCTCGCGGCCGTGGACACGCTGCGGCGGCGCATA
GCTGCGGCCGGCAAGAAGAGCTACATGGTGGTGGTGGGCAAGCTTAACCCGGTCAAGCTGGCCAACTTTGCCGAGATTGA
CGGCTGGGTCGTCGTGGGCTGCTGGGAGAGCAGCTTGCTGGAGGACGACGCCGGCTTCTACCAGCCGGTCGTCACGCCCT
TTGAGCTGGAGATGGCTCTGACGAGCGACGAGGAACGCGTCTGGGGGCTGAAGTGGTGGGGAGGCCTTGAGGGGCTCAGC
AGCGTGCCGGAGGCGGAAAAGAAGGGCGAGGGCGAGGGCGAGGGCGAGGACGAGACAGAGAGAAAGGACGGCTCAGACGA
CGAGTCTGAGTCGGAAGTGCCCCAGTTCGATTTGCGCACCGGCCGACTAGTCACCACCAGCCGACCTATGCGCAAGTCGG
CCAGGACACGGAAGAAGACGAACAAGACAGAAAGCAGTGCCGATACGGCCGTTCTGTCGGGGGCGCTGGCGCTCCGCGGA
AAGGCTGAGCTGGCCACCATCAACGGCGTGGTCAGCCCGGGCGCTGAGTTTCTCCGGTCGCAGCGGACGTGGCAGGGCCT
TGGAACCGACTACAACGACGAGGAGGAGGAGCCGAGTACGCTGATCGAGGAGGGCCGAAGCGGCATCGCACGGGGATATA
CCGTGGGCGAGGAAGCTTCGAGGACGTAGGAAGTTGGACAAAGAGAATTGAGCAGGCTGCTGGTGTATGAATGGCGTTAG
GGTTAGAATGGCCATAAAGGTCAAGGTGGAATGCATTGGTGTTTGTAAGAGACAGAAACAGCAAGACACTTCGTGCTTGT
CTGGAGGAAATGCACGTGACACTGCGCTTAGCCGAAATTCCAAGCGCCACAGCTGGAAGCACCGACGTGGCGTGTTCTTG
CCAAAGACGACGAAAAGCTGGAAGACTCGACGACGAGAGCACCGATGGTGGACGGCAAAGCAGACAAGACAGCAGCGGCA
GCCAGCAGCGGTGCAGCAGTGCGCGGGGCGTCGTTGTTGATCGTGCTGCAGATTGCGGCGCGGGCGGCCACGTTTGTCGC
CAACCAGCTGCTGCTGCGATATCTGACAGCGCAGCTGCTGGGTGTCGCCACGCAGCTTGAGGTCTACTATCTCAGCGTCT
TATTTTTTGCGCGGGAGAGCTTGCGGGTAGCGATCCAGCGGCAGGGTGGCAGAGGGGAGGAGAAAGAGAAAAAGGGCCAG
CCTGGAGACGACAGACCGAAAGGACAACGGTCGACGACAGCAATGGCCTCCCAGAGCGCCGTCAATCTGGCCTATGTCTC
GATCCTGCTCGGTGCTGCTGTGGCGCTGCTGCTCGGCTGGCTCTACCGCGCCAGCACGGCCAGCTCGGCCGTTGCCGACA
CGCCGTTTCTGGCGCCGGCGCTCTACCTCTACGGCGTGGCCGCCGTGCTGGAGCTGCTGTCGGAGCCGGCATTTGTGGTG
TTGCAGCTGCGGCTGCGCTTTGGCGCCCGTGCAGCTGCCGAGTCCGTCGGCACGGCGCTGCGCTGTGTCGTGACGCTGGG
CACGGCCGTGGTGGCGGCACGAGGCGGCGACATCGACGTCGGCGTGCTCCCGTTTGCGCTGGGCCAGCTGGCCTACGCAT
TGGGACTGCTGGCCGTGTATGGGTGGCAGGGTGCGTCGCTGGCCCGCCAGGACGGCTTCTCGCTGCTGCCACGCTGGCTG
GAGAGAGGGAGAGGCGAGCGAGAGGAGACCAAGGAAACCAACGCGACCAGAGGGAGAAAACAGTCAAACACCGTCCTCTC
CCTCTTTGACCGCTCGACACTTCGGCTCGCCTCCAGCATGACGGCCCAGAGCTTGGTCAAGCACGTGCTCACACAGGGCG
ACACCTTTCTCGTCAGCGTCCTGTCGACTCCCACGGCTCAGGGCGTCTATGCGCTGGCTAACAACTACGGTGGCCTGGCC
GCACGGCTGCTCTTTCAGCCGGTCGAGGAGAGCAGCCGGAACTACTTCAGTCGCTTGTTGGCAGGGGACGAGAAAACGGA
CAAGAAAGAGAACGCTGCCTCTCCGACCCCTCCAAACATTCTCCAGGCCAGCCACGATCTCCAGACGCTGCTGCGCATCT
ACTCCCTCTTTTCCGTCGTCGTTACCGCCCTCGGCCCCACGGCCGCCGCGCCCTTTCTTGCTCTCGTCACCGGCCCTCGT
TGGGCCGGCTCTGGTGCTGCCGCCACGCTGGCTGCCTACATGTGGTACCTGCCGCTGCTGGCGGCCAACGGCGTGGCCGA
GGCGTTTGTCGCGTCCGTGGCTGCTGAGGCTGACGTGCATCGCCAGTCCGCCTGGATGGGTGTTTTCTCGCTCATATTTG
CCGCTGCCGGCTTCGTGTGTTTGCGCGTGCTCGACGCCGGCGCTGCCGGACTCGTCGCCGCCAACGCCGTCAACATGGCC
TGCCGCATCGTCTGGTGCGCCGTCTTTATTCGGCGCTATTTTGTCGCCCGTCACGTGACATTCTCGCTTACCAAAGCCTT
TCTGCCGCGCCCAGGCACTGTTGCTGCTGGCGCTGTTGCCAGCATGGCTGTCCGCCGCCTTGTGCTGTCGCCGGCCGACG
CTGTCGGCGCTGGCGCCATCACGCAGATCCTGCAGCTCGCCAGGATCGCCGCCGTGGGCCTGCCACTCGTCGTCGCAGTG
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62