GenePrediction:GLEAN_6413 Details

Name: GLEAN_6413
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:317039..316035 (- strand)
Length: 1005
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:317039..316998 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_144:316935..316777 (- strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_144:316720..316620 (- strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_144:316557..316035 (- strand)
Length: 523
>GLEAN_6413 class=GenePrediction position=GCSC_144:317039..316035 (- strand)
ATGCCTTCTTACGTCGTGGTCGGTGCTTCTCGTGGCCTGGGGGTATGTCTCAACATCCTGTCCGCCATTCAGCAGCCAGG
GCGATTTACTTACCACCCCAACAGTATGGTTTCCTAAACGTGCTTTCTGCTGAAAAGGAAAACACCGTGATAGGCCTGGT
GCGCAACGTCCCCGGAACCAAGGCCCAGGTGGCCACGGACTTCCCGGACAGGAAGAACATCCACATTGTGCAGGCCGATC
TGAACGACAGGGCCACGCTGGTGGTCAGTATAGGACATACCCAAGCCGTGTTGACAAGCAGGACTGACTGTGCCAAAAGG
CCGCCGTGGAGCAAGTGTCTGCCATCACTGGTGGCTCGGTCGACGTCCTCATTTCGAACGCTGCTGTGGGCAGCAGCAGA
TTCCTCCCCATTGGCGAAGAGTAAGCACGAAGCCCGGAAATATGCTTAGCACAAGTTCTGACCGGCTATCGCCTGAACAT
AGAGCGAATGATGACCCGGCCGCCTTTGATGCCAACATGGAGACCCAGTTCCGCACCAACGTCCTCGGAACCATCCATGC
CGTCGCCCTCTTTGCGCCGCTGGTCCAGAAGAGCCAGCTAAAGAAGATTGCCGTGATCTCGTCTGCCATGGGCGACGTCG
AGCTAGTGCTGAACGTCGGCATCTCCCAGGGGGCTCCCTATGCCATAAGCAAGGCCGCCGTGAACATGGCGGTGGCCAAG
TTCCACAACGAGTACCGCGACCGCGGAGTCCTGGTTGTGGGCATCTCTCCTGGCGTTGTCGCTACTACCTTCGCCCAGGA
CGGAACCGAACAGGGCAAGGCAGATACGCAAAAGGCCATGGCAGTGATGGGAGCCAAGTTCATGGTGTACGACCCCAACT
GGCCCGGTATTCCATTCACCGCAGACGAGGCGGCCACGAACGTCATCAAGGTCATTACCAAGGCGACCATCAAAGACAAC
GGTGGCCTGATGGTCTCGCAATACGGCGACAGAAACTGGTTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62