GenePrediction:GLEAN_6414 Details

Name: GLEAN_6414
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:313023..310605 (- strand)
Length: 2419
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:313023..312965 (- strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_144:312807..312773 (- strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_144:312621..312577 (- strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_144:312495..311998 (- strand)
Length: 498
Type: CDS
Source: GLEAN
Position: GCSC_144:311925..311656 (- strand)
Length: 270
Type: CDS
Source: GLEAN
Position: GCSC_144:311592..311161 (- strand)
Length: 432
Type: CDS
Source: GLEAN
Position: GCSC_144:311101..310995 (- strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_144:310646..310605 (- strand)
Length: 42
>GLEAN_6414 class=GenePrediction position=GCSC_144:313023..310605 (- strand)
ATGACATCTCCCGAGCTAAACTCCCGGCCGGAGCCAGATAACACAGCATCGTTTGGCTGGTAAGCTTCTCCTGCCATTTT
TGCGTATTTCAGCTTCGAACAGGCCCTCCTCCCATCTGACCAAAACTACAGTCAGAATTGCCGAGACCAGCATCTAAAGT
GCACGTTCACGTGATTCCCCGAGTACAACGTCCGTCCTGGCTGACACCAGACAAAGGCGACCGAAAAACGCCCGTGTGCA
GTCGCTGTTTGGTAAGCGGAAAAGAATGCCATCGAGGCTACAGATTCCGAGTCAAGTCAGGTATAGCCCTTTGCCAGCTC
CGTGCGAATTAGATAGAGGCATGTCGTGCTGACCGGAGTCCCGACTTCATGATTTTTGCCGTCTTTTTTTTCACATGTGC
AGGCCCCTTCACCCGGACACAACAATGGGTCAAAACGCCCGCTACGCGTAAGTACCCTTAGCAAGCGGAGCTGGCATGCA
TGCTAGACGGAGCGCAAGCTGACACGTTACCCACTTTTGCCACTTCAGTTCAATTTGTCGATGGTGCGACAGCCGATGAT
GACTTTCCAGACGACGACGGCTTCCCAGATGCGTCGTCGTGGCAGCCAATTCGCAGCGATCGGCCTCCCAATGGGCCACA
CGCACAAGCATCAGCGCTGCAATCTGCGCAGAATAACGTCTCACAGGTGCCGGTATGGTCCACGTTGTCGCCGGACTCGA
CTGGGTCGACGCGGACCGACCAATCAACCCAGGCAGCAGCATACGACGCACCAGACAACCCGTTGCGGCTAGGCTTTGCT
CCGGCACTGAACCAGGTGGCCCAACTGCGCTCCCAGTCGCCCTCAGACCGGTTCATCGTCCACGACGAGATGGGGCCGGG
CAGTACCTTTGACCTGCACGAGGCCATCAATGCCGTTCAGTCGGTCCAATCGCGCATCTATCTGGAGAAGTCTGCCTTCC
CGCTCCAGGACAAACAGGAGGCTTTGCTTCTTCGTCATTTTGTGCAAAATCAAGCCGGATGGGCAAGTTTTCGTGTCTCC
ACCAAGCTCGTAACGGTGTTTTGCACTAAGAAACAGCACTAACCGGGGTTAATGCAAGCTACACAGCTCGACATTTGCGA
TCCTGCCCGACACTTTGCTACCACAGTGCCTCTGCGAGCCGGCACCTGTACGGTCCTGCTCAATGCCACGCTCGCCTTAG
CTGCCAAACACCTGGCACATATCAGCGACTTTGACCGCTATGCGTCCGACCGGTATCACCGCGAATGCCTCAGCGTGCTG
ATTCCGTTGATGAGCCACGAAGTCACGGCCGCGGACGAGAATCTGTTTGCCGCGACCATTATTCTACGCATCTGGGAGGA
GATGGAAGGTACGTAGCCCGTATCCTGGTGGGCGGCCGGTAAGACGTAGAGTCCTGATTTTGAGGCGGTAGTAAAACACA
CTGGAGTCGACTCGCACAGTTACATCCTCGGCATACATGCCTTTGTCCACGGCAACGGCCATAATCTACGACCGAAAACG
CTGGGTGCTGCCAGCTTCTGGGCTGGTCTGCGCCAGGAGATATACACAGCCACAATGAACCAGCAGCCGGTGAAGGCCCC
CCTAGTCTCGTCGTTGGTGGATGGGTCCCGCGAGCTTGGACCGGCCGACGATGAGGACTGGGCCAACCGGGCTGTTGTCC
ACTGCGTCGACGTCCTCAACTTCTGCTTCGGGGAAGAGCCGCCGCGGCAAACGTGGGATGGCCTGTACGCTTGGAACGAG
CGATGGACAGCGTCACTCCCGCCATCTTACACACCAACGCTGGACAAAGAGAACAGACCGGGGGAAGCATTTCCCGAGAT
TTGGTACCACGATACCTGGCAAGGTTGGTGCACAAGAGGACGACTGTGCCGGCCGGGACTGCAAAGGCTAACACGTGCAC
AGTCACCGGAGTGCAGCACCATATTCTTGCCACGTTGTTCCTCGTCAGCTTCGACCCCAGTTTTCCCCGTATTGGTGGCC
GCCGCAGAGAGGCAGCCAAGCGAATGGATGTGAGTATAGTCCTTGGGATGAAGAAGGAGGAATGTAAAATGGGAAGAGGA
GCTGACCAAATAGGAACGGATATGTGCCTTGGTGCGAAGAATTTGTGGAATTGGGCTCTGCAATCAGTGGTCACCACCCA
GTATGTTTACGGCCTGTATGGCCATTTCGGCCTGTAAGTTATTTTGAAGAGCCCCACTTTTCCGTGTATTGGCTGAAGAT
GACGAACACGAAGCTGACGTGCGGTATGCTTGTCTCAAGTTGGGGACCGATTTCGCGAGCGGCCAGATCAGGAGGCCATT
TTGGATCTTCTCCGCCGAACAGAAAGCGACCATGGGCGACCAACGGAATCGGTGCAGACTCAGATGATGCGCGCGTGGGA
CTGGGAGGGTGTGGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62