GenePrediction:GLEAN_6417 Details

Name: GLEAN_6417
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:298737..296934 (- strand)
Length: 1804
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:298737..298640 (- strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_144:298571..298246 (- strand)
Length: 326
Type: CDS
Source: GLEAN
Position: GCSC_144:298189..297336 (- strand)
Length: 854
Type: CDS
Source: GLEAN
Position: GCSC_144:297269..296934 (- strand)
Length: 336
>GLEAN_6417 class=GenePrediction position=GCSC_144:298737..296934 (- strand)
ATGTACACCTTTGGATTGAAGCCCGACACAGGGGCCGGAAAGGCCTGGCCAGCCATTGCCATCGGCATGTTTGTTGCCTT
TGGCGGCGTTCTCTTTGGGTGAGAAGTCCCCTCATTTCTCGTTCTGGTCATACTCTCCCGTTGCTAATATTTCATCGCCA
TGCCAGATATGACACCGGAACCATCAGCGGCATCCTGGCCATGCGCTACTGGATGACCTCCTTTTCGACCGGTCACATCA
ACAGCAAGGGCGAGCTCGATGTTACCACGTCCCAATCTTCTGCCGTCGTCTCTATCCTCTCGGCCGGCACCTTTTTTGGT
GCTCTCGGCACACCCTTCATCGCTGACTTCATTGGTCGTCGCTGGTCTCTGATCGTCTCTAGCTGGGTCTTCATTCTCGG
TGTCATATTTCAGACTGCTTCCACTGCCCTGCCCCTCTTCATTGCTGGCCGCTTCTTTGCCGGCTTCGGGGTCGGCCTCG
TGTCTGCTCTTAGTAAGGATGAATTTTGGTCTTGTAATCAACCACATTGCAGCTAACGCTGCTCGCAGTCCCTCTCTACC
AGGCCGAGACTGCCCCCAAGTGGATCCGCGGCATCATCATCGGTGCCTACCAGTTCGCCATCACCATCGGTCTGCTCTTG
GCCGCTATCCTCGACAATGCCACTCACAACCGCAACGACACCGGATCCTATCGCATCCCTGTCGCCGTCCAGTTTGCCTG
GGCCATCATCCTCATCGGTGGCATGCTCTTCTTACCAGAGACCCCCCGCTATCTCATCCGCCGTGACAACATCGACGGCG
CCGCCCGCTCACTCTCCCGTCTGCGACTCCTGCCTCCTGATCACCCGGCCATCACCGCCGAACTGGCGGAGATCCAGGCT
AACCACAAGTTTGAGCTCGAGCTCGGCTCTGCCAGCTACATCGACTGCTTCCGCGGCGACATGCTCAAGCGCCAGCTGAC
CGGCATGGGCTTGCAGGCTCTGCAGCAGCTCACCGGCATCAACTTCATCTTCTACTACGGCACCCAGTACTTCAAGAACT
CTGGCATCTCTGATTCCTTTCTCATCTCCATGATCACTACCGCCGTCAACGTCGCCTCCACCATCCCTGGCCTCTGGGCC
ATTGACAAATGGGGTCGTCGTCCGCTGCTGCTCTGGGGTGCTGTCGGCATGGCCGTCTCCCAATTCCTCGTCGCCATGCT
CGGCACCTTGACCACTAGCCAGGACAGCCTCGGAAATATCATCGTCCACAACGTCGCCGCCCAGAAGGCTGGCATCGCCT
TTGTCTGCCTCTTCATCTTCTTCTTTGCTTCCACCTGGGGCCCTCTTGGTTGGGTCGTCACTGGCGAGATCTTCCCGCTC
AAGCATCGTGCTCGCGCCCTCTCCATTACCACTGCCACCAACGTAAGCTAGCCCTCATCCTCCCGACCCAAGTCCCTTGT
CGTGATTACCACTTACTAACACTTCCAGTGGCTCCTCAACTGGGCCATTGCATACTCGACACCATACCTAGTCAACTACG
GCTCCGGCTACGCCAACCTGCAGTCCAAGATCTTCTTCATCTGGTTCGCCTGCTGCTTCTTGTGCATCTCCTTTGTCTAC
TTCTTTATTTACGAGACAAAGGGTCTCAGCCTGGAGCAGATCGACCAGCTATATGGAGAGGTCAAGGTCGCCCGAAAGTC
CACTTCCTGGAAGCCGACCATCACCTTCACCGAGCAGGCCCTCCATAGGGAGGAGGAGAAGATTATGGGTACGAAGGAAC
ACGCCGGGCCGAGCTTGGAGCATGCTGAGCCAGCTACTGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62