GenePrediction:GLEAN_6418 Details

Name: GLEAN_6418
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:289503..286049 (- strand)
Length: 3455
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:289503..289217 (- strand)
Length: 287
Type: CDS
Source: GLEAN
Position: GCSC_144:289163..288637 (- strand)
Length: 527
Type: CDS
Source: GLEAN
Position: GCSC_144:288606..286049 (- strand)
Length: 2558
>GLEAN_6418 class=GenePrediction position=GCSC_144:289503..286049 (- strand)
ATGCGTATTGGTGGCATCCTTCCGGGGGCCGTAGCCCTCGGTGGACTGCTCATGCGAGAGGCCGTCGCGTCGCCGGCAGT
CGAGCTGATGCCCGACGGTTGTCCGTTCCCCGTCTTCGTGCAGCCCGTCGAGGTCGTCGGCCAGTCGCCATACGTGATCG
ACGTCTACATTGCCATCAACACGACCGTCGCTCTCTGCGAGGGAACTACCGTGACTGTCACCGATGCCCCGACCCAGCTG
TCGACCACCTTTATCAAGACTATTACGACGACGTCTACTGTTACTACGTAAGCGAGTCACGTGCCATTTTCGTCTATACG
TTCCGTTCTAACCTGTCCAGCGGATCTGCTTCCTTCACTGGCCCCTTCACCACTCAGACCGGCTACTTCAGCGGTTCGGC
CGGCTCTGGTCCGCGCACTGTGACGTTGCCACCGGCTGGCGGTTCTGGCACCGGCACCGTCATCGTCGAGCTTCCCAGCA
CCACCTTCACAGGCCCTTACACGACACTGTCGGGTGCCTATGGTGGCTCGGTGGCCACGACGGTGACGCTACCACCCGCC
GGCTCCGGCACTGTCGGCACCGTCATTGTCGAGACGCCCAGCAGCAGCTTCACGGGCCCGTACACAACGCTGACGGGCCA
GTACAGCGGCTCTGTAGCGACGACGCTGACGCTGCCGCCTTCGGGCACAGCAACGGTCGGCACCGTCATCGTTGAGTCGC
CCGGCAGCTCTACCTTCACAGGACCTTTCAGCACTGTTACTGGCGGCTGGACTGGTTCGACCACGCTGACAATCTCCATT
CCGCCCACTGGATCTGGCACCATCGGAACCATCATTGTAGAGACCCCAACCTCAGGCTCCTCGTCAGGTACGTTGCCTTC
TTCTGGAAGCTCGACAGGTAGTTCATCTAGCCCCTCTTCATCTTCTGGCTCTGCATCTTCCCTTGGATCTTCGTCCTCCC
CTGGCAGCTCCTCTACCCCTGCTGCTTCCAGCCAAGGTGGCTCAAGCACTGCCATGAGTATCTCTTCCACTGTTGGGCCT
AGCGGCTCAAGCTCGGGCTCCGGTACTTCCAGCACCGGCTCCTCTGGAAGCAGCTCCTCTGGCTCATCCTCGACCCCGGG
ACTGTCTTCGTCTACATCGCAGAGCAGCGAATCAAGCACTCCTGTTTCGGGCACTGGTTCGTCAAGCTCTGGCTCCCCTT
CCAGCACTACCTCTAGCATGGAATCGAGTGGTTCTAGCACTGGGTCTACCACCGGATCTAGCACAGGACCCAGCAGCGGT
TCCAGCACTGGCTCCAGCACTGGTTCCAGCAGCGGTTCCAGCACTAGCTCTAGCAGTGGCTCTTCGAGCACTGGCTCTAG
CACTGGGTCCAGCACAGGACCCAGTAGTGGTTCTAGCACCCGGTCTGGCACTGGCTCTAGCACTGGCTCCAGCACTGGCT
CTGGCACCGGATCGTCCAGCACAGGTTCCAGCACCGGTCCCATCTCTTCGTCTTCCGCTTCCTCCACCCCTGGTTCTAGC
ACTGGCTCCACTTCTAACGTGAGCACAGGTTCGTCAAGCACTGGATCGTCTAGCTCCTCGTCTACCCCGTCTTCATCTGG
ATCATCTAGCTCCGCATTAAGCACTGGTTCGTCAAGCTCCGCCTCTAGCTCTACTTCCTCAAGCTCTGCTTCTTCCACTG
GTTCGTCAAGCACGGGGTCCTCTAGTGCCTCATCTACCCCATCTTCGTCTGGATCGTCCAGCTCTGCATCCAGTTCTGCA
TCCTCAAGCTCCGCTTCTTCTACTGGTTCTTCTAGCTCTGGATCATCTAGTGCTAGCCCATCAAGCACTTCCTCACCAAG
CACGAGTCCGTCAAGCAGTGCAAGTGCTGCTTCCACCTCTAGCACATCTTCTTCGAGCAGTGGATCTAGCTCTGCGTCGT
CGAGTGTTACATCCAGCTCTGCTTCCAGCTCTGCTTCCAGCTCTGCCTCCAGCTCTGCCTCAAGCTCTGCTTCCAGCTCT
GTGTCTTCCACTCCCAGCTCTAGCTCAGGCAGTACCTCGAGCACTTCGAGCTCGCAATCCAGCAGATCTTCACAGCCCAC
TTCCAGTGCGACGTCGTCTAGCTCTGCTTCTAACTCTGCTTCATCAGCGTCGTCTTCGCCGCCTGCTTCGTCCTCGAGTA
CTTCGTCTTCGCAATCGTCGTCCGTGACGTCGGCGTCATCTTCGGCTTCATCATCGAGCTCTGCTTCTAGCTCATCTGCC
TCGTCGTCTGCATCTTCGTCGTCGGCCTCGTCTTCGTCGGCCTCGTCTTCGTCGGTCTCGTCTTCGTCAGCTTCGTCGAC
CTCGTCCGCTCCAACTTCGTCGTCGTCTGCTCCCTCATCGTCTTCGTCGGTGCCGTCCACGTCTGCGCCCACTTCATCAG
CGACTTCATCGTCCAGCGCACCCATCTCTTCCTCGGCCTCATCTACGTCGTCGAGCCCATCGTCCAGCTCTTCCGCCACG
ACCTGCTCCACGACTGTGACGTCGGTGACGACGGCAACAGCCACAGTCTGCATCACGACTCTGCCAACGTCTTGCGCAGC
CCTCGAGACGGCCTCAGTCTTGACATACGGGGTCGACTTCACAGAGTGTGTAGCTGCTTTTGCGTTGTACGATACAGGCG
CCGTTGGAACATGCTTGGCGACGACACCGTTGTCGCTCTCAGAAGCCCAGGACGTTTACACCTGTTTGGAGACAGCCGCC
TCAGATACATGCATCACCGCGCTGCCTTCTGACTGTGACGCCCTTGAGACTGCGGGCGTCCTCGACGTGGCTGCTGACGC
CATAAAATGTCAGACCGCGCTGGGTCCGTTTGCCGTTGGGACAACGCTGACCTGTTTTGCCTCGTCGGCACTGTCTGGCG
CCGAGATGTACTCCTGTCTCGAGGAAGCCCTGGGTCTTGGTACCACGACGACTACGGCGACAAGCACAGTCGCTTTGGCG
TCTTGCCCAGTCACGTCGGCGACCTCCTCGTCGACGTCGGCGACCACGTCGGCCACAACCTCGGCCGCATGCAGCGTCAC
GCTGCCGCCGAACTGCACGCAGCTCGCGGATGCCGACGGCCTCGTCAATCTCATCTTGGAGGCAGCCGAGTGTACCACTG
CTCTCGGAGCCTACGGCATCGGCAATGCGGCTTCGTGCTTGGCCACGACAGCACTCAGCACGAGTGCCAGCGGCTCTTCC
GTTGTCGACTGTCTTACCAACGCTCTCGAGGCATCTTGCCCGACCTCCCTGCCGACTGCCTGTTCGGATCTCGCCACCGT
CACAGATGTGGCAACGCTCGTCATCGACACGGCGCTCTGTGCAGTAGCTTTGGGTCCGTACGATGCCGGTAACGCGGCCA
CGTGTTTGGCAAGCGATTCCGGATCGACCACGGGCGCGTCGATCGTCAGCTGTTTGGAAACAGCCTTCGGTATATTGTCG
GGCACCTCGTCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62