GenePrediction:GLEAN_6419 Details

Name: GLEAN_6419
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:274967..271188 (- strand)
Length: 3780
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:274967..274889 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_144:274754..274705 (- strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_144:274639..274236 (- strand)
Length: 404
Type: CDS
Source: GLEAN
Position: GCSC_144:274151..273869 (- strand)
Length: 283
Type: CDS
Source: GLEAN
Position: GCSC_144:273111..271984 (- strand)
Length: 1128
Type: CDS
Source: GLEAN
Position: GCSC_144:271910..271733 (- strand)
Length: 178
Type: CDS
Source: GLEAN
Position: GCSC_144:271666..271188 (- strand)
Length: 479
>GLEAN_6419 class=GenePrediction position=GCSC_144:274967..271188 (- strand)
ATGGCGCATCCTGTTGCTTTCCTCGCTCTCTGCTGGGCTCTCTTTGCTGCCATGACTTCCGCCTACGATGCCACAATATG
TGGCACTAACGGTTACTCTCCCCCGTCAAGCAACTTATCCTGTGCGTGCTTCTCTTCAGATCGTCGGACTATCTATTTCC
CCCTCCTCTCTTACCCCCCCTTTTCTTTCTTATCTTCCTCCTAACAGCCCCAGACAGCGCAAACGCTTGGAACGCCGAGG
CTGGCGGTTTCCAGTGCATGTCGGTAAAAATGCTCCTTTCAGAACCTTATCAAGGCTACCTACCGTCCCAGGCTAATTCC
AAGACTAGATCACAAACTCTCCCCCGTCGTTCGATGCGCGGTGGAGCTGGCCGAAAAACGTCACCAGTTCCGTGCACTCG
TTCCCCTACGTCTCCTTCATCGGAAACGAGCTACCGGCTGTCCTTTCCAACATTTCTGCGCTGCAGCTCGCCACTCAGTG
GGGCATGGCCCCAGGATCGTCAGCCACCAGTTCCGTCGGCCATCACCTAGACACCTCAGGGCTCGCCACTCAAGCCACAA
AAGCCAATGTCGCCTTTGACATGTTCCTCCATCCCAATGCATCCAAGGCTAATGATGCCACCACCGCATCCGTTGAGATC
ATGATCTGGCTGGCCAGTGTTGGTGGTGCCAAAGCCCTTGGATACGCGACAAATCGAACCTGCTATACCCAGAAAATGGG
TTCTGTTGACTAGTAAGATTTTGCCCTTTTTTAGGTCGGAATCTCCTTTCACATTCCTCTCCCCCCACGCCGTCAGACCT
TTCATTCCTCTTCTAGTCTGCCCGTTCCCCTAAGTCTCTGGCTCACGTCTACCAGTATCCTATACTCCGGTGTCAACCAA
CGTGGCCTCAGCGTTTACACTTGGGTGCCCGAGAAAAACGAGACCAGCTTTGACCAAGACATCTCGCCGCTGCTGCAGTA
TTTGTGGCGCAACCAGTTCATCTCGTCCAATCTCACCCTCGGCCTAGTGCAGTTTGGCTCCGAGGCATATTCTTCGCAGG
GGAATGTGACCTTTTCCGCCTCGGGCTTCGCCATGGATCTGGAGCATGGCGCCGCTCCGGTGCTGGACGTCTCTCCCCTG
CCAACCACTTGTCATTCATGGACGAATAAGAATAAGGCCAGACACTTGCGCGCGTGGGTAACCGCAGCGTCGTGCACTGT
AGTGGCGCACTTGTTGAGTAGTTGAAGAACTAGACAACACTTAGACAAAGACAAGTCAGACAAGTCGTATGGAATTGCGC
TAGCTGTAAGAAAGGGATGTTTTGTTCTCAGTCCAAAATTCGACTAGGACGTTATACAGCCAATCCGAGGTCTAGACCAA
AACTCACAAACACTGCATCCATATCGTCCGTCTTGCGATCGTGAGTCCATTCCGCACTCACCCTGGATCTGGGCTCTTGC
AGCGATGATAGTCTAGACTTCACGAATACGATAGACATGAACCTCGCCGTCTAGTGACGGGCAACCGGCCCAGCCACCCC
GACGAGGCCCAGACCTCTGTTGTTTGGCCGGTCTTTTTCCTGTCCTTTCCCGTCATGATGCGAGCCTATAAAGAGGCATA
TCGTCACGGTCACTACGCCACCATCTCTAGTCATGTCATCTTTCTTTCTACCTCCTCTCTCGTTACAAAAACAACAGACG
GAGAAAGGGTTTCTTTGATTTTCCATTTTCATAACGCTCAACACAAGGGCCATGTGTACTTCTCCCGTTCTCGCCGGCAC
GCCTCTTCCACCTGTGAGTCACCAAGCTGGCCTAGAGATTGTATGTTACGCCTCCCCTTTGCTCTCTCTCTTGTCCCTTG
CCTAACATGTTGGCAGACGCTCATTCCCGGTACTCTGCGTTCCGACGAGACTGTGAACAACGAGAAGGCTGTGGACCCGT
TTGACGACGATGTAGCATCTGCCTCGTCGCTGCCAGGCATCCCGGCAGCCGGGCCAGAAGGCACAGCCACGGGCAGAGAC
GCCGAGAAGGCGGCAGACACCGGCGACACCGGCGACAGCACTGGCAATGCCAGCCCCAAGCGCGGCTATCTGTACAGCGC
TGCCGCGTGGACGCGCGAGACGTACTGCCCGCGGGTCGAGGCTGCCCTGGTGCTGCCGACCTGTCCGACCGATGCGGAGA
AGCTGAGCTATGTGCACACGAACCGACTTCCACTGTACATCTTTGGCATCTTCTCCTTTTTCTCGCTAGCCACCGGCATG
TGGCTGTTTGCCCTCTGCGACGTCATCTTCGTGTGGTACGCCCCCTTTGTGGCCTTTGTTAACATTTATCTGCTCATCTC
CTACCTGGTCGGCATCGTCGGCAAGGACTGGGACTACCAACGCCACCTCGACCTAGCTGTCGCCCACCCTATCACCGACG
AGACCGCGCCTACGGTCGACATCTACCTGCCCGTCTGTATGGAGCCGGTCGGGATCCTGGCCAACACGTGGGCTTACGTC
GTCCGCCTCGACTGGCCTGTCGACAAGCTGCGCATCCACGTGCTCGATGACGGTGCCCAGCAGGACGTCCAGGACCTTGC
CGCCCGCTTCGGCTTCGAGTATATTGTCCGCGACGACCGCCCGCGTCTTCGCAAGGCCGGCAATCTCCGCTGGGCCTTTT
CCCGCACCGAGGGCGACTACTTTGTCATCTTTGACGCTGACTTCTGCCCCCGCCCCGATCTTATTCGCGAGCTCGCCGTC
GAGCACCTCGCCGACCACACCGTCGCTATCGTCCAGTCTCCCCAGTTCTTCCGCGTCGTGCCTGAACAGACCTGGGTCGA
GCAGGGTGCCGGCGCTACCCAGGAGCTCTTTTACCGTGTCGTCCAGGTTAATCGCAACCGCTGGGGTGCCTCTATCTGCG
TCGGCAGCAATGCCATGTACCGCCGAGCTGCCCTAGAAGAGGTCGGTGGCACCGCCGACATTGGCTTCTCCGAGGATGTG
CATACCGGCTTTGGCTGTGTTGATGTGAGCATTTGCTTTTGTTGAATTATAGCCGCGTTACGTAATCCTATACTAACTGC
CGTTCTCACTCTTGCAGCGAGGCTGGAGGGTTAAATACATCCCCCTTTGTCTGGCTACAGGCGTCTGTCCCCCTACGCCG
CGCTCGTTCTTCTCGCAGCAGATGCGCTGGGCTCGCGGGTCTACAACGCTGTTAACAAACAAGCACTTTTGGACGTCTAA
TCTAACGCTAATGCAGAAGATCTGCTATATGTGCGGTAAGTTACAACTATCTAGACTTGCTGTACAGAACCCGACTAACT
CTGTCCCCGTACTTATAACAGGCTTCTTCTATTACTCTGCTATATCATTAAGCATCTTTACGTCTCCAATCCCCGGCATC
TTCGTCTTAGCCTTCCGCGAATCCTGGTTCAGGTTCTACAACCTGGCCTTTGCCATCCCATCCATCTTGTATGGATTATT
CGTGTTCCGGATATGGGCCAAGGCCAGCTATGGCCTGAACGTGCAACACATCATGTTGATCCAATCATATGCCTGCTACC
TGACAGCAATCAAGGACCGTCTGTTTGGTATCGAACTGCTGTGGGCTGCGTCCGGCGATGCCAAGGCGCACAAGAGCCAC
AAATACCGCAACATGCGCATTCTCTGCTGGATCTGGACACTCCTGACCTTTGGTGGTATGGTTGGGGTCGTGTCGTGGCG
GCTGGCCACTGGTTTCAAGTGGTACAATCCGATCCCTCTCATCGTGCTCAACGTCTACAACACGTATTTAGCGCACCGCT
TTCTGTTCTGCAACTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62