GenePrediction:GLEAN_641 Details

Name: GLEAN_641
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1148958..1150745 (+ strand)
Length: 1788
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1148958..1149005 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_97:1149080..1149841 (+ strand)
Length: 762
Type: CDS
Source: GLEAN
Position: GCSC_97:1149900..1150561 (+ strand)
Length: 662
Type: CDS
Source: GLEAN
Position: GCSC_97:1150616..1150745 (+ strand)
Length: 130
>GLEAN_641 class=GenePrediction position=GCSC_97:1148958..1150745 (+ strand)
ATGCATGAACACGAGAATTTGACGGTTGCTGGCGACGCCTTTGCTCGCGTGAGATTCTTGTCCCTTTTGCCGCAACTTGC
CGTTGCGGCACTCCCCTTTCCATGCCTGCTAACGAAACTCAGGCTCCGGTGCCAACTCCCGATTATATTCCAGCAATACA
CCCCATACAGCCACTCACTTCGTCTCCGGTCCCCATCCTGCCTGGCCATGTTCCTCTTCTCCGACCCGCCATACCTGGCG
CTAGAGCCGGCGGCGCCTCGCGTGCTCCTCGTCTTGGCCTTGCTATTCCACCCTCTCCTAATGTGAAGCCCGTTGGCACA
ACTGTCCCACCACATCAGCCCGTGGTCCGCCCCTCACTACCAGTTTTACACCTCGCAACTCCCATGGGCAGCCAGGGAAT
TCCACATGAGCAGCCGGCTGGCCGTGTCTTGGGCCCGGCACTCCATAGTGCTTCGGGTGGAAGTGAGAGCAGTGCTGCTC
ATAGTCGCTCAGGCAGCTTCAACTTACTGGACGGCCGTGCCAGCAATCCTACGTCGGCCGGATCGCAGTACTCTGCGCTC
TCGTTTGCTAGTCAGTATGGCATCGGTAACTCGCGCCCGCAGGGAACGCCCGACCCGGTGTCGGCTGTCGGGTCTCTTTA
TTCCGAACTGAGCGAGGGTGGTGTCGGCATGGAGCGAGAGAGCAGCCTTCAAGGCCTGGAATCATTTGATAGACTGGCTC
TTGAAAGGGCCCGAACACTAGACGTGGAAGAGCTAGACGACGAAAGCTGGCGCATCGCTAGTTTGGAGAGAAGAATCGTT
GAGCTAGGAAGCTTAGGAGAGGGAGCCGGTGGTGCAGTAACGCGCTGCAGGCTTGAAGGAGGGAAGACGGTATTTGCGCT
CAAGGTGCGTGGACAATTAATCAGTGCACACGTCTAATCCTGAAAAATTGCTAACATTTTAGGTCATCACCACAAACCCG
GACCCTGATGTGAAGAAACAGATTGTCCGAGAGCTCGGCTTTAACAAAGAGTGCGCATCTGAGCATATCTGCCGGTACTA
CGGCGCCTTTGTCGATCCGTCAACAGCCACGATCTCCATTGCTATGGAGTTCTGTGAAGGCGGCTCGCTCGACAGCATCT
ACCGCGAGGTCAAGCGGCTCGGTGGCCGCACAGGCGAGAAGGTCTTGGGAAAGATTGCCGAGGGCGTTCTGCACGGGTTG
ACCTATCTGAACTCCAAGAAGATCATCCACCGCGACATAAAGCCGTCCAACATTCTTTTGTGTCGGAACGGCGAAGTCAA
GCTGTGCGACTTTGGCGTGTCGGGTGATTTTGGCACTAAAGGGGAGGCGAACACTTTTATCGGCACAAGCTACTACATGG
CACCAGAGCGTATCACTGGCCAGAGCTATACCATCACTTCAGACGTCTGGTCGACAGGTGTCACGTTGTTGGAAGTGGCG
CAGCACCGCTTCCCGTTTCCGGCCGATGGAACAGAGATCCAGCCACGTGCGGGCCTCATCGATCTGCTGACGTACATTGT
GCGTCAGCCCATCCCAAAGCTCAAAGATGAGCCGGATGCCAACATTTTCTGGAGCAACAACTTCAAGTACTTTATCGAGT
CCTGGTGAGCACATCTCGCACCTCTTGCTTTGTGGAACCATTGCTAACTGTGTTACAGTCTCGAGAAGGAACCAAGTCGG
CGAGCCACTCCATGGCGTATGCTCGACCATCCTTGGATGAAAGAGATGAGCGCCAAGCGAGTCAACATGTCCCGATATCT
GTCCAAGGTCTGGGGATGGGATGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62