GenePrediction:GLEAN_6420 Details

Name: GLEAN_6420
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:270669..269734 (- strand)
Length: 936
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:270669..270586 (- strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_144:270523..270498 (- strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_144:270414..270347 (- strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_144:270260..269734 (- strand)
Length: 527
>GLEAN_6420 class=GenePrediction position=GCSC_144:270669..269734 (- strand)
ATGGCGCCCGCAGAGAAGGAAAAAGACAAGTCCAAGGTGCACAAGCTGTCGCTCAAGGGTAGTGCAAAGCTAGTGTCTGA
ATTTGTACGTGCATTCTTGTTTGACGAACCTGGTGACACTGTTGGCTGATTGTGCCTTTGCTGCAGTTCCAATACTCCAT
CCACACGATCCTGTATGCCGACGCATCGTTTTTCCGTCCATTCCTCTTCCCTGTCCGGCCGTGAGGGAGCACGAGGACTG
ACAGACCGGTTCCAGGTTCCAGCGCGGCGTCTACCCTGCCGAAGACTTTACCGCAGTCAAGAAATATGGCCTGAACATGC
TGGGTGAGTGGAGGAGAGTGGATCTGTGTCTGCTATCGGGGCCGCCGTCAGGCTGTCGAGCCGCCAAGCTGACCAGAGCG
GTGCTGCAGTCTCCGCAGACGACCAGGTCCGCGCCTACATCAAGAAGATCATGGGCCAGCTCGACCGCTGGATGGCCGGC
GGCAAGATCAGCAAGCTCGTCCTCGTCATCACCGACAAGGACACGGGCGAACACGTCGAGCGCTGGCAGTTTGACGTCCA
GATCATGGCCGGCGCCAAGACCAAAAAGTCCAAGTCTTCTTCTGCTGCTACTGCTGCTGCTGCCACCGCCACCGAGACCG
ACAAGGAGAACGGACAGAAGCAGGCCCCCGAGAAGGAAAAGACCGAGGCCGAGATTCAGGCCGAGATCGCCGCCATTTTC
CGCCAGATCACCGCCTCCGTCACCTTCCTGCCACAGCTGGCTGGCGACTGCACCTTCAACGTCCTCGTCTACGCCGACGC
CGACAGCGACGTCCCTGTCGAGTGGGGCGACAGCGACGCCAAGGAGATCGAGAACGGCGAACGTGTCCAGCTGCGCGGCT
TCAGCACATCCAGCCACCGTGTCGACACGCTCGTGAGCTATCGCTTGACCGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62