GenePrediction:GLEAN_6421 Details

Name: GLEAN_6421
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:258520..255656 (- strand)
Length: 2865
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:258520..258442 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_144:258381..257876 (- strand)
Length: 506
Type: CDS
Source: GLEAN
Position: GCSC_144:257677..255656 (- strand)
Length: 2022
>GLEAN_6421 class=GenePrediction position=GCSC_144:258520..255656 (- strand)
ATGAGCGGCCAATCACACGCGAATGGCAGCGGCCCGGGGCGGAGAAAGGTGCGCAAGGGGACGCACAGCTGTTGGGAATG
TAAGTTGCATGCAAGGCCCTGCCGTACGGCTGATGGGTGGGCGATGCTGACGCTGGCAGGCCGACGACGGAAGATCCGGT
GCCAATACACGCACGACAATGACACGATCTGCATTGCCTGCCGGGCACGAGGCTCGGCGTGTCGCAGCCAGGAATTTGCG
GACGAGGCCGTGGCCGTGGCGCCGGAACGCAAGGTGACGTTACGGCTAGACCGATTGGAATCGATGATGGAGCGGCTGAT
GCAGCACATCCTGATGAGGCGGTCGGGCGAGTCAGTACGCGGCGGCAGCAGCTCAGCGGCAGCATCACAGCGGTCGTACG
TGCGGCCGTCATCGCCGGCCTTTTCCAGCGGAGACGCAGATAGAGACGGAGACGGAGACGGAGACGGGGACGAAAGCTTA
CCGGCTGTGAGCGACATGCTCACGGACCTGCCGACAGTGGCAGCCCGGGCCTGTCCGACAATGTTGAAGAAGCACGGCTA
CGCGCACATGGACGTGTTTGACACGTCGGCCGCGGACGACACGCCTGTGGCAGCACTGCTGGGCATTCAGCAGTCGCTCG
CACACGTCGACGGATCCGAAAGCGGACGCAAGGACAGCATGGCGACAGATGGCAGCAGCAACGGCGGTGGTGGTGGTGGC
AGTGGCAGCAACAACAACAGCAACAGCGGCAACGCAGCGGCAACGCCAAGCAGCAACGCAGACTCGGACGGCGGCAAATA
CGGCTTCCTCAGCAAGACGCTGCGGTCGCTGTTCCCGTCGCAGGCCGACTTGGACGTGATGGCACGCGGACCGCCGGCAT
ACCACGTCGTCTCGCTCTTCCACAGCCAGCACGATCGGGACGCAGGGCGTGGCGAGACGCCCGAGAGCCTGGCCGAAGTG
CCACCGGCCGGCAGCCACCCAACGCTGGTGGCACGACGGCTGCTACAGCTGACACTCTGCATGCAGCAGGCAGCGCCACA
GCTGCAGCTCGCAGGGCTGCCAGACGGGCTCCGGCTGATCGACGTGGTCGGCCGCATCGCCGACATGGTGGCTCACACGG
TGGCAGCAAGCGACGAGCTGATCGGCAACGTCGAGGGCCTGCAATGCCTCGTGTTGCTGGGCCAGCAGCAGTCCAATTGC
GGACACCTGCGCCAGGCCTGGCTGAGCTATCGTCGCGCCCTCGGCCTAGCCCAGTTGATGGGCCTCGATCGCGGCAATAC
GCGCGCGCTAAGGTCATGTGACCCGCACGAAGACCCCAGCCGCCGGCCTTCGCCTGCAGCTCTGTGGTACCGGATCATCG
CGTGCGAGCGCTACCTGTCGCTGATGCTGGGCCTGCGTGCCGGCACGCCCGACGGTGTCTTCGACCTGCCGACCGACACG
CCCGTCGAGCGGCTGGCCAAGGCCCACACGCTGCTGACCGGCCGTCTGATCGAGCGGAACCAGCACCACCAGGGCAGTAG
TCCTCCCTACGCCGTGACCCAGGCCATCGATGCCGACTTGCAAGCTGCCGCCACGTGCGACCTTGATCCTGCCTGGTGGG
ACGTGCCGGCCTACGACCCTGTCAGCGCGTCGCCCGCCTGCATCTTCGGCCAGACTACCCGCTCCATCCTGCAGGTCAAC
CACTACTGCATCCTGATCATGCTGCATCTGCCCTTTATGTTGCGCGGCAGCGACTCAGCCGCTGCTGCTGCTGCTGCCAC
GGCCAAGACATCGACGGTCGCTGGACAGCCGACGACGGCCACCTCGGCTCCAACTCTCCCCTTTACCACGTCAGCATCAG
CTCCCACCACCGCTATGCTCACCTACAGCAGAGATACGTGCATGCGGGCCAGCCGTGCGCTGCTGCGCCGCTTCACCAGC
TTCCGCCAGCTCGTCAGTTCGGCCAACTCGTGCCGCCACGTCGACTACTCCTCCCTCATTGCCGCCATGACCCTCATCAT
CGGCTACCTGGGCCCACGCCCGTCCACCAGCCTTCCGGCCGCCGTCCAGGCCGCCTTTGACGACCAGCTGCTCCAGGATC
GCGCCATGGTCGAGCAGGTCCGCCTCCTCATGCTGCACTTTGGCAACACCAACAAGGACCGCCTCTCGCTCGAGTCGGCC
GCCACCATCCAGAAGCTGCTGCCGCTCCTCGACCTCGTCTTTTCCACGCCCGAAGCTGCTGCCGCCACGAAGCTGCCGAG
CACCGCTCCATTCCACCATCAACAGCAACAGCAACAGCAACAGCACACGACCAACAGCATCGGCACGTCCCCCTGTCCCT
CCCTCTCTCCCAACAGCCATTTTGCCGCTGCCATAACATACGCTCCGGCACCGGCATCGGTCGCTGCTCCTTCCATGTCC
CCCGTGCGCCTCAACGTGCCCTACCTTGGCACCGTTAACATCCACCCCAACATAGCTGCCCCGGCCGGCGTGCAGACCGC
TGCCATCCCTCCGCACCTGTATCAGAATCAGAACCAGCATCAGCACCAGCACCAGCACCAGCATCCGGCGTCGGCCCTCT
CCTCGTCCACCTCTTCGCCGTCGCCCTTTGGCCTGCTCTCTCCACAGCCGGCCGTGCTGTCCTGGCACGGCGGCGACCTG
TCGATGGCCGAAACTGGACCGCTGGACGTCCCCGACCTCAGTACCATGCTCGTCGACTTTGACACCATGACAGACGGCAA
CGGCGCCGCATTCGACGGCTTCGGCGCCTCTGCCGCCTTCCCCGACATGACAGGCGCGTCCGACGACTGGGCAATGCAGG
GCGTCGACACGACGTACTGGTCACTCCTCAACGGAGGCGGCGGCGCCTTTGGTTGGGGGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62