GenePrediction:GLEAN_6422 Details

Name: GLEAN_6422
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:254704..253803 (- strand)
Length: 902
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:254704..254298 (- strand)
Length: 407
Type: CDS
Source: GLEAN
Position: GCSC_144:254217..253803 (- strand)
Length: 415
>GLEAN_6422 class=GenePrediction position=GCSC_144:254704..253803 (- strand)
ATGGTGACCACTCGCGGAAACGGAAGCCGAGGAGAGCGGAAGATGAGGACCGGTCACATCACCGAAAACGGCATCATGAC
GACGACCGAGATCGGGACGATAAGAGGGTGGAAGGAAAGGGGGACAAACGGAGCCACCATACGTCTCGCAGCAATGGCAG
GCGCGAAGGCGAGCAGCAGGAGGAAAATGGGGAGCAGAGCCGACACCACAGAAGCTCCAGGAAGCACAGAAGCCGACATT
CTCATCGCTCTCGGCGTGACAGCCGATCTAAATCGCTCAGCAATAGCGATACGGACATGGACGAAGAACGCCGACAGGCT
AATAAACGTCGACGGGATCGACACGAACGCAGCAGGCGAGACGAGCGACCAAGGCACAGCAACCGGTCACGGTCACGGTC
ACCCAAGGTTAGAGATGGTAGGCTGGATCGAGAGAAGCGACATCGACATCGCGAGCGATCGCCGCTCTCCGCGTCGTCGG
CGCACAGACTCAGCCGCGACAAAGTGACGCCTGGCAAGGCAGAAGCAGCAGCGGACTCCGACTCGGACTCCGACCCGCTG
TCTGAGTTTGTGGGGCCCCTGCCAGCTTCGGACTCGCGTTCTGCAGCGGCAACCGTGCGCGTTCGCGGCCGTGGAACCGT
GGCTGGAGCATCCAGCATGGACCTACACTTCTCCGCCGACTACGACCCCTCCCAGGACGTGGGACAGCCGGAAAGCGCCT
ACGCTGGCGACACGCCCACCGTCGAAGACGCCCGGGCAGAGATGCAACGCGACCGGCAGAGCATGTTGCGAGAGGGTGCG
GCACGGCTTAAGGCAGCCGGGTTCACCGACCGTGAAATTGCCATCTGGACGCGGGGCGGCAAGAGAGACGTGGCAGACAT
CCAGTGGACCAAAAAAAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62