GenePrediction:GLEAN_6424 Details

Name: GLEAN_6424
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:249245..247947 (- strand)
Length: 1299
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:249245..248879 (- strand)
Length: 367
Type: CDS
Source: GLEAN
Position: GCSC_144:248803..247947 (- strand)
Length: 857
>GLEAN_6424 class=GenePrediction position=GCSC_144:249245..247947 (- strand)
ATGACGGACCTACCTGATGCGAACGCGAAGATGGATGTGAACGCAGCGCTGCCAAGGGCACAAAATGCACCGGCCGAGAC
TGCAGACACTGTGATGGAGGGTACACACGAGAGCGAGAATGCATTGAACAGCGACAGCAATGCTGTTGCAAACCCGAGCA
AACTACGAAAGTCGCATCTTCTACAGCGGCTATGGGAGCAAGAGCAAGAACAAGAGCAGGTGGTTGACAAATCGCTGAAG
GTGCCATCCTTGGATGAGCAGGCGCGTGAGAACTTACGGCGTTCGATCGCGTTGGCCCTACAACACGTGGGCTTCCAAGC
GGCGACGACCGAGGCTCTCGAAAGCTTTTTGCTCATGACCGAGACGTGTGAGTGAAGCCTGATACTCTGTTTACTACTTC
ATCGCCTCCTTGTTGCACTTACTGATTGATAATCGCATGCAGATTTACATTCTCTCGCCAAGGACGTCGTGAGCGTGGCC
CATGCTGCCCGCCGCAGCCAGCCAATCCCAACGGACTTTGACCTATCGTTTGCCCGCTTCAATCTGACCACATCGGCCCT
GCGGCCTCACCTGCGGAATCCTGTGGCCATGTCCAAGCTTGCACCTGCGTACTTTGACCCCCTGGCGCGGCTGGAGCTTC
GCGGCCAAGAACGCGACCTGCCACTGTTGAGCGATGAGCTGAGTGGCAAGGCTGAGAAGGATGCAAAGCCTTACATTCCC
GAAGGGTTCCCCGATTTCCCTAGCATCCACACATACCGGCACACGCCCATTGACGTCGACACGGTCACCGTGCAGGGCAT
AGGCATGCGGTACGATGATGGAGAGCCGGTGCAGTTCCAGGACGATGTCGGAGGTGCCGATTCGCAGCAGTTACAGCTGC
AACAAACATCGACTGTCGGGGCAGCAACAGCGGCCGCCACAGCGGCCGCAGAAGCCGGAGCGGCAGGGAGCCTGCGCAGC
GATCCTAAGAGGATCCGCGAGGCGGCGGCCGTCGAAGCGAAACAGGCTGAAGAAGCACTGCGCAGCCTCATGCGTGCCAG
CAAGATTAACAAGCTGAAGGAGGTGCGAGCTGCAGCAGAGCGCAACTCTCTCAGCAAGCAGCGCTACTCGCTGTGGGAGA
CGGCTATGCGCGAGCTGATCGAAGAGAGCACGACCATATCACAGCCCAGCACGGTGCTGACTGCCGCGGCCCTACGGGAG
GAGATTGCTGACCAGAGCATGATGGTCAACGCCGAGAAAGCGTTCCATCGGAAAGAGATACCACGGAAACCAGCAAAACG
ACTGGCACAAAAGACCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62