GenePrediction:GLEAN_6425 Details

Name: GLEAN_6425
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:247371..245910 (- strand)
Length: 1462
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:247371..247330 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_144:247146..247109 (- strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_144:247037..246593 (- strand)
Length: 445
Type: CDS
Source: GLEAN
Position: GCSC_144:246335..245910 (- strand)
Length: 426
>GLEAN_6425 class=GenePrediction position=GCSC_144:247371..245910 (- strand)
ATGTCTGAGCAGCTCATCCTCAAGGGCACCCTCGAGGGCCACGTACGTTTTGCACCTCCCCGTGTTTTGTCTGGCCGGCT
TGCATCTTGTTTCGAGAGACAGAGGATCTGAAGCATCAGAACTCGGAGAGGGAGGACGGGATGCTGGCTCTGGGACAGGA
GAAGACGGACGGCCAGCCTGTTTTGTGGCACGGCGACATTGTGGCTAATTAGGGTTGTTGAACAGAGCGGCTGGGTCACC
AGCTTGGCCACGTCCATCGAGAAGTGAGATACGATTCCGATCCTGTGGCGAGCCGATTTAGGGACAGAAAGGGAGCTTAT
GCTGACAAGAACAGCCCGAACATGCTCCTGTCCGGCAGCCGCGACAAGTCGCTGATCATCTGGAACCTCACCCGGGACGA
GTCGCAATACGGCTACCCGAAGCGGTCTCTGCACGGTCACTCGCACATCGTGTCTGACTGTGTTATCTCTTCCGATGGCG
CCTACGCCCTGTCTGCGTCGTGGGACAAGACCCTGCGCCTGTGGGAGCTTGCCACCGGCACGACCACCCGGCGGTTTGTC
GGCCACACCAACGACGTCCTGTCCGTGTCCTTCTCGGCCGACAACCGGCAGATTGTTTCCGGCTCGCGCGACCGGTCTAT
CAAGCTGTGGAACACCCTGGGCGACTGCAAGTTCACCATCACCGACAAGGGCCACGCCGACTGGGTGTCGTGTGTGCGTT
TCTCGCCGAACCCGCAGAACCCCGTCATTGTCTCGGCTGGCTGGGACAAGCTGGTGAAGGTACGTTTTTTCGCCCGTCTT
TGGGACACGTTTTTGTCGTACCTGCCCCTCACCTTCCCCCCATACCAAATGATGCTTTGCAACCTATAAAGTATTTGCTA
CTTCAGAGCCTTTCGGCCATGAGACAACTATAACACCAATGCACTGATGCTATGTTCATTCTACCTCTTTATGTTGTGGA
TTCCAGCTTCTGGAGCCATCAATTCATCCTGGTTTTGGGGCCTGCCGCTAACGCTGTCTGGTTCGAAACACAATAGGTCT
GGGAGCTTTCGACCTGCAAGCTGCAGACTGACCACATTGGCCACACCGGCTACATCAACACCGTCACCATCTCCCCCGAC
GGCTCCCTGTGCGCCTCTGGCGGCAAGGACGGCACCACGATGCTGTGGGACCTGAACGAGTCCAAGCACCTGTACTCGCT
CAACGCCAACGACGAGATCCACGCGCTCGTCTTCTCGCCCAACCGGTACTGGCTGTGCGCTGCGACGGCGTCAAGCATCA
TCATCTTCGATCTCGAGAAGAAGACCAAGGTGGACGAGCTCAAGCCCGAGTTCCAGGCCGTCGGCAAGAAGAGCCGCGAC
CCGGAGTGTGTGTCGCTGGCCTGGAGCGCCGACGGCCAGACGCTGTTCGCCGGCTACACCGACAACATCATCCGTGCCTG
GGGCGTCATGTCAAGGGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62