GenePrediction:GLEAN_6426 Details

Name: GLEAN_6426
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:245185..243189 (- strand)
Length: 1997
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:245185..244711 (- strand)
Length: 475
Type: CDS
Source: GLEAN
Position: GCSC_144:244657..244552 (- strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_144:244412..244193 (- strand)
Length: 220
Type: CDS
Source: GLEAN
Position: GCSC_144:244142..243189 (- strand)
Length: 954
>GLEAN_6426 class=GenePrediction position=GCSC_144:245185..243189 (- strand)
ATGGGCAACTCAGACACGGAGTCTCGCGATGCGTCACTTGACGGCAGTGCTGGCCAGACCGACAGCTTTGACTATGGCGA
GACCGAGGGCCTGCTGGCGGAGAGTTCGGCCCTCTTGACGAACATGGATGGCGACGACAAGAGCTCTCTGCCACCACCGC
CTTCAAAATCGCAGCAGCAGCAGCAGTCCGAGGTGGTTCGATGGCGCGACCTGCCGCACAAGGGCCAGCTGACGGTGCTG
ACGTTGGCGCGGCTGAGCGAGCCGTTGGTGCAGACGTCGCTGCAGTCGTACATGTTCTACCAGCTGCGGTCGTTTGATCC
GTCGCTGCCAGACTCAACCATTGCCAGCCAGGCAGGCATCCTGAACGCCAGCTTCACGGCCACACAGTTCCTGACGGCTA
TGCTGTGGGGTCAGCTGGCCGACTCACCGCGCTTCGGCCGCAAGCACGTCCTCATGATCGGACTCTCCGGGACCAGTGCG
TGTTGCTTGTAGGACGAGCCAAGGAGCAACGCTGACCCGAAAAACCAGTGCTCTCTTGCCTCGGCTTCGGCTTCTCCCAG
TCCTTCTGGCAGGCCCTCTTTTTCCGCTCCCTGGGCGGCGCCACAAACGGCAACATCGGCGTGTTGCGGACTATGTATGT
GTCGATGCATCTTATAAGTATCTAGATGACTAATTCATTCTTGTGTAGGATCAGCGAGATAGTACGGGAGAAAAAGTAAG
CAGACCAGACCGTGAATTTGAGTGTTTGCTGGCTATCCGTCTGACAGAAACAGATACCAGTCGCGAGCGTTCTTGCTGCT
GCCCATGACCTATAACATTGGCGTCATCATCGGGCCCATCCTCGGTGGTCTCCTGTGCGATCCGGCAAACAGTTATCCGA
CCCTCTTTGGCGACAATGCCTTCTTCTTGCGGTTTCCCTATGCGACGCCGAACCTGCTGAGTGCCTTCCTGCTCTTTGCT
GCCACGCTGGCAGTCTGGATGGGCCTTGGGGAGGTGTGCTTGCCGTCCTATTCTCTCTCGGCCATTTTCTGACCAGTTCT
CAGACACTTGATTCATTGCGTGGCAAGCCCGATTACGGGTTTGCACTGAGGCGCAAGATCGTCTCGCTCTTCCGACGTGC
ACCGACCGGCGACATTTCATACGTGCAGCTGGCCACAGAGGACGATGCGGGCGAGTCTGCGGCTCTGCTCCCTGCCGCAT
CGACGGCCAATAGGCCAAGACGAGCGCGGTACACGCAGCGGCTGTCTTTCCGGCGGATGCTTACCAAGAACGTGACACTG
ACACTGCTGGCGCAGTGTATCTTTGGCTTCCACCTGGGCGCGTTCAACTCGCTCTGGTTCATCTTCCTGTCGACGCCGGT
ATACGATCCGGCCAAGAGGCCGGGACCGGTCGGCGGGCGGTTCTATTTGCAGCCGCGGGCGCCCTTCTTCTTTTCGGGTG
GCATCGGCCTGCCACCGGCACAAGTCGGCTTGGCCATGGCGATCCTGGGCAGCTTCGGGATCCTGATGCAGCTGTTTCTT
TATCCGACCGTGTCAGGTCGGCTGGGCACGCTGCGGTCGTGGCGGCTCTTCCTCTGTCTCTTCCCGCTGACGTACTTTCT
GGTGCCGTACCTCAGCCTCGTTCCGGGCGCGTCACCGTCGCCACACGCAAAAGACGGCCCGACCATTTGGCTGGCCATTG
CGGCCGTGCTGCTGCTGCACGTCGTCGCCCGCACGTTTGCGCTACCGGCCCAGACCATCCTCATCAACAACTGCACGCCG
CACCCGTCCGTGCTGGGGACGCTGCACGGGCTGGCCCAGAGCACAAGCTCGCTGACCAAGACGCTGGGACCGGTTCTGTG
TGGCTACCTGTACGGCTTCGGCCTAAACCACGGCATCGTCGGTGCTGTCTTCTGGGGTCTCAGCCTGGTGGCCGTGTGGG
GCTTCACGGCCAGTCTGGCCGTGTATGAGGGCAACGGACACGAAATCTGGCTGGAGGGCGACGCGGAGGAGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62