GenePrediction:GLEAN_642 Details

Name: GLEAN_642
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1155624..1156249 (+ strand)
Length: 626
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1155624..1155782 (+ strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_97:1155989..1156249 (+ strand)
Length: 261
>GLEAN_642 class=GenePrediction position=GCSC_97:1155624..1156249 (+ strand)
ATGGCAAAGGGCAAAGCGGCCGAAACCAAGAAGGGAGGCGACAAGAAGGGAGGCGACAAGAAGGGAGGCGACAAGAAGGG
TGGCGACAAGAAGGGCGGCAGCGATGCCAAGAAGGGCGATGTCAAAGGCGCCCAGCAAATCAATGTCCGGCACATCTTGG
TGAGATTTCTTTCCTTGTCCTCCTCCTTTCTCTTTGTCTGTTCCATTCTTATCTCTTCTGCTTCTTCATTTCCCCCTCTC
CCTCTTCTTCATTTCCCTCTCTCCCTCTTCTTCTCCTTCCACCCTCTCCTCTCCTATCCCTCCCTCCTTCACCTTCCCAT
CTCATACCTCCTTCTATTGCAACTTTCTCACCTCCTACCCTCCAGTGCGAGAAACACGCCAAGAAGGAAGAGGCCCTGGC
CAAGATCCGCAGCGAGGGCGCCAAGTTTGACGACGTGGCCCGCACGTTTTCCGAGGACAAGGCGCGACAGGGCGGCACCC
TCGGCTGGAAGGTCCGCGGCAGCCTGGACCCAGCTTTTGAGGAGGTGGCCTTTGCGCTGCCGGCGAGCACGACGGTCTCA
CCGGTTGTGGGCGAGGCCAAGACGTCTTTTGGATATCACATCATCATGGTGGAGGGGCGCAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62