GenePrediction:GLEAN_6474 Details

Name: GLEAN_6474
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:640384..638176 (- strand)
Length: 2209
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:640384..640085 (- strand)
Length: 300
Type: CDS
Source: GLEAN
Position: GCSC_168:640037..638918 (- strand)
Length: 1120
Type: CDS
Source: GLEAN
Position: GCSC_168:638633..638176 (- strand)
Length: 458
>GLEAN_6474 class=GenePrediction position=GCSC_168:640384..638176 (- strand)
ATGACCTCAGATCCGCCTCGCTCGCTTCACTTTGAGGCCAGCTCAACCTCATCAGCTCCATCGCGAACATCGTCCTCATC
GTCCACCCTCAAGGGCTTCAGCAAACCTCTAGCGAACAAAGTTACGGCGGTTCTCTCGTCTTCCTATGCCGACTCGGAAT
TCCGCGACTCACTCGCTTTGCTCGACGACAGGCACGTTCAGAACACCGCAGAAACGAGGCGTCGACTCCGTCTGGACATT
CAGAAAGAGGTTATCGAGAGCAATGGAGAGGTCATCGCCGAGTTCGGTCGGGTTGCAGAGGTTAGCTTCCACCAGAGGAT
TTCGAGATTCTGTCTGACAGAAATTAGCAACTGCGTCGAATTGGCAGCACCATAGAGGCGTTGAGCACGACGTACAGCAG
TATGAAAGCAGAAATAACGGCAGCACACAGTGCTACCAAACCAGTCTTGGACGAGGCCTCAGTCCTCATAGATCGCCGGC
GGAATGTAGAGACACGACGACGCCTTCTTAGCGCCTTCATCGGTCATTTCGTTCTCACCGAGGATGAGGTCGCCATACTG
ACATTGACTGCCGAGCCTCTAGATGATCGGTTCTTTGCCGTCTTGAACAAGGCGAAAAAAATCAGCACAGATTGTGAAAT
CCTTCTCGGGTTTGAGGACAACCCGTCACTCGGCCCAGAGATCATGGAGCAGACTTCTAGGAACATCAATCTTGGCTTCC
AGAAGCTTTATAAATGGGTCCAGAAGGAGTTTAGGCACCTCAACCTTGAGAACCCCCAAATCAGCTCGTCTATGAGCCGA
GCTCTTCGAGTTCTTGCGGAGCGCCCAGCCCTGTTTCAAAGCTATCTCAATTCGTTTTCCGAAGCTCGGGAGAGCATCCT
CTCTGACGCTTTCTACACGGCGCTTACCGGCAGCAACGAGAGCGGCTCGGAGATTGTGTCATCCATAAAGCCTATTGAGC
TGGCCGCTCACGACCCGCTACGCTACGCTGGAGATATGCTTGCGTGGATGCACTCGGCTACCGTTAGTGAAAGAGAGGCG
CTGGAAGCACTGTTTGTGGGGGACGGAGGCGGACTTGCCAGGGGCATACAAGAGGGTCGGGAAACAGAAGCCTGGCTCCT
CGCATCCGAGGAAGAGAGCGCGGATGCAGGCATATTTGACCCTGTAAAGGCGCTCAACGATCTTGTCGATCGCGACCTGT
CGGGCGTCACCCGAATCTTGCGTCAGCGCATGACCCAGGTCATTCAAAACAACGAAGAGACCATCCTGGCGTACAAGCTC
GCCAATCTGCTCAATTTCTACCGGTTAACCTTCGGCAAGCTTCTCGGTGCCGGCGTTGGAGGCAACAACAACTTGACCGA
CGGCATACAGGACAAGCCCGGCCTCGTGGAAACCCTCAGCAGCCTCGAGTCTGAGGCGCTGCGCCATTTCCGGTCCCTGG
TGCGCGACCATGTAGCCACGCTTCGGGGTGATTTCGGCCAAGCCCCCTCTGATCTAGCACCGCCAGACTTCCTCCAAGAC
GCCTTGAAGCAGCTCGTTTCCATAATGAAAACGTTCGACACGTCACTAGCTTCTCACTTAGCAGCCGAGAAGCCGACTTT
GCGCCCGTTCTTGAAGAGGCATTGGACCCATTCTTGGTCGGTTGTGAGGAAATGGCTAAAAAGGCAAAGGAACCACTAGG
AAGCCTTACTTTCATTCTGAATTGCTTGGCTACCGCCCGAGAGACACTGGCATTGTATGATTTCACAGCAGGCCGGCTTT
ACAAGCTTCAGGAAACCATTGACAGCAAAGCGCGTGCTCTTGTCGAGCACCAGTACTCCTTCCTCTGCCACCAGTCTGGG
CTAGAAGACATGTTTGTTGCTTTGGGGCAGCTCAGCGCGGAAAGAAAGGAAGACCTGGAAATTGCGGTGGGCCTGGATGT
TTTGCAGCCGCAAACGTTGGTTGAGATCAGCCAGTATCTGGACGACTTCTTGCCGTCAGCTCTGGTGGATGCTATTGACA
ATCTCAAGGCACTTCAAGACCCCAAACGGGCACGGCAGGTCACAGAGGAGGCAGCAGAGAGGTTCTGTGTCGATTTCGAG
CATGTGGAAAAGATTATCGTTGCCGCAGACGAGCTCCTTTCCGAAAAAGACGAGGACAAGGATCCGGACACAGCGCTGCG
GGCATTGCTTCCACGGACGAGCGTTGAGATCCGGGTGCTACTTTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62