GenePrediction:GLEAN_6475 Details

Name: GLEAN_6475
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:637741..635002 (- strand)
Length: 2740
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:637741..637646 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_168:637581..637070 (- strand)
Length: 512
Type: CDS
Source: GLEAN
Position: GCSC_168:636995..635284 (- strand)
Length: 1712
Type: CDS
Source: GLEAN
Position: GCSC_168:635222..635002 (- strand)
Length: 221
>GLEAN_6475 class=GenePrediction position=GCSC_168:637741..635002 (- strand)
ATGCTGCATACAAGTTCATCGGCAGCCTCCAGCCTGCAGAGAATATATGAGGATGGCTACCTGAAATGCTCGACGGCTGT
TTACTACGAAGGACAGGTAAGTTCCTTCTCAATACAGGATACGTTTTCATGGCTAGAATGGCCACTAAGTCGCTCCGCAG
GGCAATGAGGAAGAGGCTATGCGATGCTGGAGATCGGCTGTGGAACAAATACGTCACCAGTGCTCCGAAACTGCGGCCCC
AGACTTTGCAGCTCTTTCAGAATCCGAAAAGTCGCTGGTCAACAGTCTGCAGGAGCTGGAATACCAAGCACAGGAGCGTG
TCGATCTCCTTGAGGCCTTGAGGCTGTCTCGTCGGGATTCCTCCATTCACCGGAACGGTTCTCCAACGGGAGCGGGAAGC
ACTTCTGGCACCGGCATGGGGACAGACCTTGCAGCTGGAGCTGGTTGGATAGGCGGCGGAACGATACCGGCCGTGAAGTA
CGGAGAACTATCGCGTCCTCTTCCAGCTGTTCCTCCACCAGCTCCTTCATCAGCTCCACCACCAATTCCTCCACGGCGGC
CGGTTTCAAACTCACAGGCTGCGCCATCCAAAGAGCCTGCACCATCCCTTCCCGAGCACGGCATCCGCAAAAGTAACAGT
GGCACCGCAAACGGCCTGCGCTACGACCCGAGGTCAACCCTTTCAGCGATCCGGACACAGTTCCGTCGCCGTCTCACCGA
GACGATCTCACGAAGAAGACTTCCAGGTCGCCTTCTCGTGAGAAGCAGCACACACTGAGGCCGACCTTACGGACGGGAAA
TTCGGGCGAGGCTCGTCGCAAGAGCCATCGCTCTTCCAACTCAAAGCCATCGTCGGATCGGAAGTCAACTTCTGAGCGGA
TGGGTGCAAGCAAGGCCGCAACCTTGGCATGGAGTGCACTAGGATTCTCATCCGGAAGGACGGAAAGCCCGCGAACTCCT
ACCAGCACCGAACCACCTTCCTTGCCAAAGCTGCGGGATGACTCGCCAAGCTCCAGCACAGTTCCGATGCAATGGGACAG
CAACTCTAGACGTCTCGTTCCGCAACGACCTGCGGCTGATTCAATTCCTGTATCAGCAAGCAGGGCCAGCTTAGATTCGG
CCATTGCAGCAGCCATTGATGGCCGCGGTTCGGGAGAATATGCGGCTCCATATCAGCCCTCATCATTGTCCCTGAATGCT
GCCGCAAGCGCTCTCAGTCGCTCCTTGCAGTCTGCTGCAGACTCGCCTCGCTCAAAACGCTCGTCGTCCAACCAACGGCC
ATCAGTGGCTGCCAGTAACTTACCGTCTAGCATCGAAAGAGGAGGCTCGGCCTCGAATTTGGATTACGCAAAACCGAAGT
CGACGAGCCATCGGTTTGCGGGTGGGAGTAACACCCCAACCAGTCGAGTTGAATTGAGGCGAAATGCTCACTCTAGCACA
TCAGTTACCCATATTGTCGCATCGCCGTTGTCGGCATCCGAAAGAAACACGGCGTCTGGAGCACATGCTATCCTGCGGAA
GCGCATAGCACGAGGAAAGGAGAATGCGGGCTCTAGGATCGACCCGCAGACGAATGCGACGAACCAAGTTTCTCACCTAC
TGGCCGACGTGCAGCTAGAGCCCTCATCCAGCGATGATTCTGACAAATTAGATGGGAGCCAAACACCTGACAAAGACGTG
GAAGGAGAAGGCAGTAACCCGTGGAAGAAACGGAAACAGGCCATCCTCAAGCACCTACCTCCCGGTGTTGACGACGAAGC
TGCCAAGCAGATTTTGAATGAGATAGTGGTGCAAGGGGACGTCGTCCACTGGAGCGACATCGCCGGCTTGGAACCGGCAA
AGAAGGCGCTACGCGAGGCTGTCGTATACCCGTTCTTACGGCCCGATTTGTTCATGGGCCTCCGCGAGCCGGCCACAGGC
ATGCTTCTCTTTGGACCGCCTGGAACAGGAAAGACCATGCTGGCACGTGCTGTCGCAACTGAGTCCCGATCGACATTCTT
CTCCATCTCGGCGAGCAGCCTAACCAGCAAGTACCTCGGCGAGTCGGAGAAGCTTGTGCGTGCGTTGTTTGTACTGGCTA
AGACACTGGCCCCGAGCATCATATTCGTGGACGAGATTGACAGCATCCTCTCCCAACGATCTGGGTCGGGCGAGCACGAG
GCGACTCGACGCATCAAGACGGAGTTCTTGATCCAATGGAGCGATCTCCAGCGGGCTGCCGCCGGACGCGAGGACAAAGA
CGCGGCTCGCAACGGCGATGCCAGCCGAGTTCTCGTTCTGGCCGCAACCAATCTGCCGTGGGCAATCGACGAAGCAGCCC
GCAGACGGTTTGTGAGACGCCAGTACATTCCGCTTCCCGAGGCGGAAACCAGGGCTGTGCAGCTGCAGACGCTGCTTGGG
CAGCAAAAGCACAACCTGGGCGATGACGACATCCACAAGCTTGTCACACTGACAGACGGTATTGGCCTCCTTTCCACTCC
TCTCCCTCCCACTCGATGCTGACGATTGGATTGTTACAGGGTTCTCCGGCTCGGATATCACGGCATTAGCGAAAGATGCC
GCCATGGGTCCGCTGCGGTCGCTGGGCGAAGCTCTTCTCATGATGAAGATGGATGAGATCCGGCCAATGGAGCTGTCTGA
TTTCATTGCCAGCCTGCAGACCATCCGGCCCAGTGTCAGTAGATCCGGACTGAAGGAATACGAAGACTGGGCTGGGGAGT
TTGGGGAACGAGGAGGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62