GenePrediction:GLEAN_6476 Details

Name: GLEAN_6476
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:628599..627361 (- strand)
Length: 1239
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:628599..628563 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_168:628186..627915 (- strand)
Length: 272
Type: CDS
Source: GLEAN
Position: GCSC_168:627837..627361 (- strand)
Length: 477
>GLEAN_6476 class=GenePrediction position=GCSC_168:628599..627361 (- strand)
ATGTCATCTACCGAGTACCGTGCTGGCAAGAGACCGCGTAAGTACTTATTGATCCCTTAAGCCATAATGCTGCTCGACAC
CCATTTTGGTGTTGTTGCAGATCGTCTGCAACGATCGATTGAAGTCTGCTTGATCGATTGGAATGCCATAGGTGCAGGGC
CGTCTTCGTCGCAGCTCATTATATGCTGGAAAAGCTTGCGTTGCTTGTCCTTTGTTAGCAAGCTGCAAGAGCTTGCGTTG
CTTGCCCTTTGTTAGCAAGCTGCATGAGCTTGTGTTTATTGTTCTTTGTTAGAAAGCTACATTGGAGCAGAGGGATACCT
GGCGGGAAGTGATAAGACGATGAGATGGCCGATGAGGATTGATGTTTTTTTTTGTGAGGAACCAAGGCCCTGATGACCAC
CCCTCAATGACAGGAACCCAGTCTCTGCCGCCCCCAGCTCTCCCACAGCTTGTTGCAGAGCAACACCACCCTATTTCGTC
TACCGACCATGACTCTAGAAGGCTCATTGTCGTTCTCGCCAACGCCAGCCTCGAGACGTACCGTGCTGCTTCTCAGAACA
GTGCGGCCAATCGTCTTGGCCATCGGGACGAGAAGTATTCTCTGCTCAATAGCGACGAACACATTGGTGTCATGCGCAAG
ATGAACAGAGATATCAGCGATGCCCGGCCCGATATCACACACCAGGTTTGCCTTATCATAAATCCTGCTATCGCGGCTGG
TGAACTCTTCTGCTAAGTCTTTACCGCGCTTGCCTCTCACAGTGTCTGCTCACATTGCTTGACTCGCCAATCAACAAAGC
TGGCAAATTGCAGATCTACATTTTGACGGCAAAAGACGTCCTGATTGAGGTGTCTCCGTCTGTCCGGATACCCAGAACCT
TTAAGCGGTTTGCTGGTTTGATGGTGCAGCTGCTCCACAGACTGTCCATCCGGTCTACTAACTCGCAGGAAAAGCTCCTT
CGGGTTATCAAGAACCCCATCACAGACCACCTGCCGCCAAACTGCAGGAAAGTGACGTTGAGTTTTGATGCCGAGGTCAT
GCGTGTGCGTGACTACGTCGACAACCTCGATGACAATCAGAGCATCTGCGTTTTTATCGGAGCTATGGCCAAGGGCCCCG
ACAACTTCGCCGATGAGTTTGTTGACGACAAGATCTCTATCAGCAATTACAGCCTCTCGGCAAGTGTTGCGTGCAGCAAG
TTCTGTCATGCCGCAGAGGATTCCTGGGGCATCATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62