GenePrediction:GLEAN_6477 Details

Name: GLEAN_6477
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:623758..619441 (- strand)
Length: 4318
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:623758..622372 (- strand)
Length: 1387
Type: CDS
Source: GLEAN
Position: GCSC_168:622110..622103 (- strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_168:621477..621383 (- strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_168:621316..619441 (- strand)
Length: 1876
>GLEAN_6477 class=GenePrediction position=GCSC_168:623758..619441 (- strand)
ATGGCCGTTGCTTACCGGCCGTCCCACAGCTATCCAACACAAACACAGTATGGTACATCATCTATGTCCCGGCGGCACCA
ATTCGGAGAGTCGGAGCCGCCTCGCGTGATCAGCTACGATCACAGCCCTCCAGCCGCAGAGCCGTCCCGTTCGTACTCCA
GCAACCACCCCCGGTACCACGATTCGGCCGACTATTATGCCGAACCTGCTTCACACTCTTCGCCTTCCTCACGCTACCAC
ACGGGCGGCGGTCTGCAGCGGTCCGCCACATCCGCAGCTGTATACGAGTCAGCACCACGCGAACAACCCAAAAGTGTGGC
GGGCATGTTTGGCATGGCCGCAGTGGGCGCTGCAGCTGGAGCAGCGTTGACCTATTCTGTGCTGTCGGGCAGATCGCCGC
GCGACCGTTCGTCCGAAGAGCCCGCAACTGCTCCGAGCTTCCAACGCCGATCCACCTTCCCGGATCCCTACCCAGCTTAC
GCACCCCCGCGCTTCAGCAGCCAGGAGGGCATGCGAGCGAGCTCGCGGAAGGAGAGCCGTGAAGCGGAGGATATGTACGA
ATACGACGAAGGCCGTAGTCGCCATTCCTCGTCGCGCCAGTACCGGTCCAGCAGCCGTCCGGCTAGCCGGTCGGTCAGCG
AGGCCGCCCCAGGCCGTACGCCTCTGCTCATCGCAGAGGATGAGCCCCGGTATGGCAGCAGCGGCGGTGGCAACTATGCA
CCACCTCGCTACGACGTGTCTCACGCACCATCGCGCCATGATCTATCCCACACGCCGTCGCGCTACGATGCATCCCCTGC
ACCATCCCGCCATGATTTATCTCGCACGCCGTCTCGCCATGATCCATCGCGTGCAACATCCCACTATGACACAACCCGTG
CAACTTCCCACTACGATACGCCCCGCGCGGCCTCCCACCACTACGACGCGGCCCATGCGCCGGCCCATGCGCCGGCTCAT
GCACCAGCTCATGCGCCACCCTTGTCGCGTCGCAGCGCCACTTTCGATGTTCCTCCCAGGGCTGATCCCAGAGCTGATTT
CAGGCCGGACCCCAGGGTTGATCTCAGGGCCGATCCTAGAGTTGACCCGAGGATGGAACCGGAAAGCTACGTCTCATCCC
GCAGCCATCGCACAGGCGTGACTATCCGGGGCGGTGGCAGCGCCAGCCGGCATGCAGCAAAACCCCCCAGCGCCAGCCGC
GGCGCAACAGTGCGTCACTCTTCCAGCCGGTCTGGCAGCTATCGCTCGTCGCGCGATATGTCTCTGCCCCAGAGCGGTGC
GGGCGGCAGCCATGCGAGGTGGGACGCCTATCCGAGCGACGAAGAGGAGGTTGACCCGATGCTTTTCGAAGACAACGACA
GCGTTGCGCCGAGCGACAGCATTAGCTGTGTGGGTAGCCGGGGCCAGCGGTATTAACTGGGGTTTATGCTTGGGTTTCTA
GACTTGTCTTCCTCATTTACATGAGCATTGTGTAAACTTGTTTCGGTGGGTCTCAACTCTGGTTGTTCCTGGGAGGGGGT
GGCTTGTCTTGCTCTGTGGAGATTGTAGAGAGTACAGAGGACGAGAGATCGGAAGGAGAACCGGGAAATGTGCAACGGAA
ACGACATGAGTAATGTATCTAACATCTTTGACACAGTGCCTGTGATAGGGCAGTCTGTAAGTGACGTCGGCACCAGGCTT
GAACGAAGCATAGCAGCCTGTTTTGCCATTAAATGCTGCTACACGGGAAGGTGAGGTGACGCGAGATGAAGAATGGCTCC
TCTGGTGGGAATAGACGGAAAAAATTGCTGCCGATAGTCGGCCGTAACAAGAAGTCGTAAGGAATTGCGGCACGGAGATC
ACCGGGCTAGCTCGAAAGAAGAGCGCCCCTTCTGGAGAAGGAAAAGACAAAAAGCTCATTTCTTGATGAATGACCTGAAC
TACATGTTGATTGCACCTGGTAGTCTGAACATAGGCAGGAACTACCGGACGGCGGAGTTGGAGGGGTATCATTGCTCTAA
TTCAATTTTCTCTCTAGATTCGGCTATTCTCAACTTTTTGCAGACGAATACCGTTGTGGCTAGACCACCAATCTCCGTTT
TCTGAGTCACTCGCCACAAGCAAAGCAGTTGGATATCGGAAGAAGCTGCTGGCGTTCAATCCCATATTGCCAACTCTCCC
CTGCTCCCACACTCACGATGGTGACTATCGGTTTGGGCGAATCCATACCTCCTGACACGGAGCACGTGCGTTATATTCCC
TTCCGGCGTGATGAGACTGTGATACTGACGCATATGGCCAGGCTGTAAGCGTGTCACTCCCCACGTGGGCGGACAATGTT
GGCTACGAGGAGGGCAGGTTGGAGGTCCTGTCAAAGCTGGTCACGGGCTATCCAAGGTGGGCAGTCTCGTCGAGGGTGCA
GACGTGGGAGTATGCGGACAGCTGACCGGATAACCGTTGCAGATTTTTTGTCCACAAGAGCATCCAGGCTTTTGCTGCCA
GCATAGCTGAGCGGTACGGCCAGGCGGGCCAAACAGCCATGCTGTTCCCCAGCGGCGCGGCGGCGACGCGCTGTCTTGCC
TTCGTCCAGAAGATAGCGACGCCTCCGTCTGTGCTGGACAACATATCTATTGTGCACCTGGGCTTGAACGTTTCCCGGCC
AGACGCGTCACCATTCAGGCCGCTGGCCCCCACCATCTCAGCAGTCGTTTATAATCCAGAGGTCTTCCCGTTTGCCAAGC
AGTACTGGCAGCATTCCGGTGACGGCGTCTCCAGTCGTCGTGCCGAGTATTGCCACAAGCTGTTTGGCAAAGGCCTGTTG
ATACGCGTGTCCGAAGACGCTGGAATTGGCAGCGGTGCACGGCAGGCCGAAAGCGGCCTTGTGCCATCGGCCCTCTCGCC
GACACTGACACCAGCAAGAGCGCCGGCCGTGTCGCCGTCGACGCAGCTGCCGACTTCCGTGAAGCCGTTTCGCGGCCCCA
AACGCTACCGTCGTCCGATGTCGCAGTCCGGCGATATTCTTCCCCAAGAGCGGCCGCTGACGCCGCGATCTGCAGGCCAC
AGCCCTGATGCTGCCGACGGCCAGGGGGTGGACGAGGACGAGACGGCGCGCTTCCTGGAAGAGCGGTTTGGGCGGAACCT
TGATCTGTCATTTGTGCGGCGGGCAGGCTCGGCGATCCGGCGGCGCATCACCGGGGCCCTGACGGCGGACAACGAGGTGG
ACCTCGACACGCAACCGTCGACGCCGGTGGCAGCAGCAGCGGCAGACGCCAACAGCAGCAACATCCGCGGCACCGAGATC
ATCCGGGAGGACGACGTGTACCTCTACCCGTGCGGTATGAACGCGGTCTTCAACGCACACCAATACCTTCTGGCCAGCCG
AAAGGAGAGCGCGCCGCTGCAGAGCATCAACTTTGGCTTCCCCTACGTCGACACGCTCAAGATCCTGCAGAAGTTCGGCG
GCGGCTGTCTGTTCTACGGCCGCGCGTCAGAAGAGGACCTCGACGATCTGGAAGCACGGCTCAAGGGCGGAGAGCGGTTT
CTGGCACTGTTCTGCGAGTTCCCAGGCAACCCGCTGCTGTCGTGTCCGAACCTGACGCGCATCCGCCGGTTGGCCGATGC
CTACGACTTTGCCGTGGTGGTCGATGAGACCATCGGCACGTTTGTCAACATTAACGTGCTGCCATTTGCCGACATTGTGG
TTAGCAGTCTGACCAAGATCTTCTCGGGCGACTGCAACGTCATGGGAGGCAGCCTGGTGCTCAACCAGAAGAGCCGCTAC
TACTCGGTGCTCAAGGCAGCCGCCACGGCGCTCTACAACCAGGACAGCTACTGGCCCGAGGACATTATCTTTATGGAGCG
CAACAGCCGCGATTTCGCCGAGCGCATCGACCGGATCAACGCCAACGCCGAGGCCGTGTGCGAAGTCCTGCTGGCCAGCC
CGACGGTCAAGGAGCTGCACTACCCCAAGTACGGCAAATGGCGGGAAAACTACGAGGCGTGTCGGATCGGCGGCGGCCAG
AAGGGCACCGGCGACCATGAGGGCCGTGTCGGCGGTTATGGCGGTCTGCTCTCCTTTGTCTTCCACCGCAAGGAGCAGGC
CGTCGTGTTCTTTGACGCTGTGGCGACGGCCAAGGGTCCTAGCCTCGGCACCAACTTCACCCTGACGTCGCCCTACGTTG
TGCTGGCGCACTTCACCGAGCTGCCGTGGTGTGCGTCGCTGGGCGTCGACCCGAACCTGTTGCGTGTCAGCGTCGGTCTC
GAGGACACTGCGGCTTTGCGGGGGACCTTCCAGTCGGCGCTGGATGCGGCGCAGGCTGTAGGTCAGGAGACCGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62