GenePrediction:GLEAN_6478 Details

Name: GLEAN_6478
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:616899..615116 (- strand)
Length: 1784
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:616899..616781 (- strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_168:616661..615116 (- strand)
Length: 1546
>GLEAN_6478 class=GenePrediction position=GCSC_168:616899..615116 (- strand)
ATGGGAGCAGAGCAGTCCACGAACCGGAATGCCGGCAGCGCTGCTCAGGCACCGGCCGCCTTGCGAAAGACATGTTACTA
CGAGCTGTTGAGTGTTGAGCGAACAGCGACAGACGAAGAGTGCGTAAGCCGGTCGAGAATCTTGTATCTAGATATCACCA
ACCGGTTTTGTGTCTAGACCAGATGTCTCTGGATCCTTCTGACTTTTCAGCTCGGTCGCTGACATCACCGTGAGCCAGAA
TAAAGAAAGCATATCGACGCAAAGCTCTGGAGCTGCATCCGGACCGAAACTTCAACGACACGGAAAATGCCACCCGCAAA
TTTGCCGAAGTTCAGACAGCATATGAAGTCCTGTCGGACGCCCAGGAACGAGCCTGGTATGACTCGCACCGCGACGCCAT
TCTTCGTGGCGACGACGACACAGCCGATGCCGACGGACAAGAGGCGTCTTCGCGCTTCTACAACAACGTCCGCCTGACAC
CCACCGAAGAGCTCTACACGCTCATGGGACGCTTCAATTCCAACGTGCCCTTTACCGATTCTCCCACCGGCTTCTTTGGC
ATTCTGAACGAGACCTTCGCCCAGCTCGCTCTCGAGGAAGAGACCGTATGCAGCTGGGATGGGCAGGAGATCCCGATACA
GTACCCACCCTTTGGCGAGGCGGCCGATGGCTACGATGCCGTTGCTAAGCCCTTTTACCGTGACTGGTCCAATTTTGCAA
CGCGCAAATCGTTCAGCTGGAAGGACAAGTACAGGCTTTCGGATGCGCCAGAAAGAGCGGTGCGCCGCCTCATGGAGAAA
GAGAACAAAAAGGCCCGCGAACAGGCCCTGCGCGAGTTCAACGACGCCGTGCGATCTCTCGTTGCTTTTGTGCGGAAGCG
CGACCCACGCTACGTGCCAAACGTGCAGTCCGAGGCCGAGCGCCAGAAGATCCTGCGCGACTCAGCCGCTGCGCAGGCAG
CTCGCCAGCGGGCGGCGAACCAGGAGAGGCTGACCGCGTCCTATGTCGAGCCCGAGTGGGCACGATCCCGCCCCGGTGGC
GAGACAAACGAATACGAAGGCGGGTTTTCGAGTGACGCTGAATCTGAGGTGGTCGAAGAGATTGAGTGTGTGGTCTGCGA
CAAGTCGTTCAAGAGCGAGAAGCAGTTCGAGGCGCACGAGAAAAGCAAAAAGCACATCAAGGCTGTGCAACAGCTGAAGA
GGCAGATGAAGAGGGAAAACGCCGAGCTGCGCCTGGATTCCGAGCCTGAGCCCGTGCTTGCACCCGCACCCGAGCCGACA
TCGGAAGTAGAGCACAACGAGACAGGGGAGACGATAGCAGACCCTGAAGATTCTGGTCGCACGGAACACAAAAGTACTCC
TGACCGGAAAATTGACGGGCAAAACGACGACGAGGAAGAGGAAGAAGAAGAGGATGAAAACGACGAATATGCTCCGAGAG
ATGTGGTCGAGAAGCGTTTTCTACCCGTCCAGGACGATCAGTCTGACGGTCCTGTTGACGCCGACGGCTTGGCAGCTCAG
CTGGACGATCTTGACATTGGCCAGAGCCAGGCCTCGATTGCGCAGGCCAAGAAGGTCGGCAAGGCCAAGGCAAAGAGGGA
CAAAAAGGCAGCGCGCCAAGCTGCTGTCGCCGCAGATCAGCCGGATTCGGTGAAGACAGCTTGCAAGATTTGCAGCATGC
CCTTTGCCTCAAACACGAAGCTACACCAGCATCTGAAAGCAGAGCATCCCATGTCCGAGCCCACAAGGAAAACAAAGGCA
GGCAGCAAAAAGAAGAAGGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62