GenePrediction:GLEAN_6479 Details

Name: GLEAN_6479
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:604345..601785 (- strand)
Length: 2561
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:604345..604144 (- strand)
Length: 202
Type: CDS
Source: GLEAN
Position: GCSC_168:604073..603940 (- strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_168:603860..602018 (- strand)
Length: 1843
Type: CDS
Source: GLEAN
Position: GCSC_168:601945..601785 (- strand)
Length: 161
>GLEAN_6479 class=GenePrediction position=GCSC_168:604345..601785 (- strand)
ATGTCTGTCATGTTGCATACGCCCTCGCGAGCTTCCACCGCCTCCTCCTCCTCGTTCCAGCCCGTCTCCCGACAGAACAC
CATGTCGTCCTACGATGGCTCGCGGTCTGCCCGCCAGTCCAAGCGGTACTCCATGTCCGCCCTGTACATGTCCATGTCGG
CAAACGAGACCGACCTGGAGATCGAAGACGAGCTTGCCAAGGGTATGTCCTTATCGAATTGCTGATGTTCTGCCTCGCTC
TGCTGACAACTTGCCGTTTCCCCCCACCACAGCACAGAAGAGACTCCGCGACCTCAAGGCCAAAATCTCGTCCCAATCGA
AGCAGAACTTTGTGCTGGAAAAGGATGTGCGCTATCTCGATTCGAGAATCGCCCTGCTGATCCAGAACCGTATGGCGCTG
GAGGAGGTATGTCGGACCTGTGGACGCGTGTTTGCACTACGAGCTTCCGTGTTTCCGTAGCTTTGCGCTGACCTCTACTT
TCTAGCAAAATGAAGTTGCTAGCCGTCTCGAAGATACCCCGGAGCTGCAGGTCGGCGCCTTTCCCAATGACGACAAGACC
CAGAAGTACGGCAACCTCATGTTCTTATTACAATCCGAGCCGAGGCATATTGCCCACCTGTGCCGCCTGGTTTCCATGTC
CGAGATCGACTCCCTGCTCCAGACTGTCATGTTCACCGTCTACGGAAACCAGTACGAGAGCCGCGAAGAGCATCTGCTCC
TGACCATGTTCCAGTCCGTCCTCACCTACCAGTTCGACAACACCCCCGAATACTCGTCGCTGCTGCGCGCCAACACTCCC
GTCTCGCGCATGATGACCACCTACACGCGGCGTGGTCCCGGCCAGAGCTTTCTCAAGTCCGTGCTTGCCGACAGGATTAA
CAGCCTGATCGAGCTCAAGGACCTCGATCTAGAGATCAACCCGCTCAAGGTGTACGAGCGCATGGTTGCCCAGATCGAAG
AAGACACCGGCAGTCTGCCTGCCTCTCTACCCAAGGGCATCACTGCCGAGCAGGCCGCCGAAAACCCTCAGGTTCAGGCC
ATCATCGAGCCGCGCTTGACCATGTTGAGCGAGATTGCAAACGGCTTTCTGGCCACCATCATCGACGGCCTGGATGAGGC
GCCCTATGGCATTCGCTGGATCTGCAAGCAGATCCGCAGCCTCGCCAAGCGCAAGTATCCCGACGCAAACGAACAGATCA
TCTGCACGCTCATCGGCGGCTTCTTCTTCCTGCGCTTCATTAACCCTGCCATTGTGACGCCCAAATCATACATGCTCATC
GATGGCACTCCCGCTGACCGGCCGCGTCGCACCCTGACGCTCATTGCCAAGATGCTGCAGAACCTTGCCAACAAGCCGTC
GTACGCAAAGGAGCCGTACATGGCCAAGCTGCAACCCTTTATCCACCAGAACAAGGACCGCGTCAACAAGTTTATGATCG
ATCTCTGCGAGGTCCAGGACTTTTACGAGAGCCTGGAGATGGACAACTACGTCGCGCTATCCAAGAAGGATCTCGAGCTG
TCCATCACCCTAAACGAGGTTTACGGCATGCACGCCCTGATCGAGAAGCACTGCAACGAGCTCTGCAAAGACCCAAACTC
TCACCTGGCCATCATCATGGCCGACCTGAATACAGCCCCTCCGCAAGTGCCGAGGAAGGAAAATCGGGTCATCAACCTTC
CGCTATTCAGCCGCTGGGAGGCCGCTCTCGACGACCTCACCGCTGCTCTTGACATCACCCAGGAAGAGGTGTATTTCATG
GAGGCAAAGTCCGTTTTTGTCCAGATCATGCGATCCATCCCCCAGGGCTCGTCTGTCTCTCGCCGCCCATTGCGTCTGGA
GAGAGTAGCCGACGCAGCGGCGACGTCCAAGAACGACGCTGTCATGGTTCGCAAGGGCATCCGTGCCATGGAGCTGCTTA
GCCAGCTGCAGGAGATGAAGGTCACCGACAAGTCCGATGGGTTCTCTCTCCTGCGCGACGAGGTGGAGCAGGAGCTGCAG
CATCTGGGCTCGCTGAAAGAAGGCGTCATCACCGAGATAACGAAGCTGTCAGAGGTGTACGCCACCATCACGGATCACAA
CACCTACCTGAACGGCCAGCTGGAGACGTACAAGAGCTATCTTCACAATGTGAGAAGCCAAAGCGAGGGAGCTCGCCGCA
AGCCCCAAAAGCAGCAGGTGCTCGGCCCGTACAAGTTCACGCACCAGCAGCTGGAAAAAGAGGGTGTTATCCAGAAGAGC
AATGTGCCTGACAACCGGAGAGCCAACATCTACTTCAACTTCACTAGTCCCCTGCCAGGCACTTTTGTCATATCTCTCCA
CTACAAAGGTAGGTAGTATGAAATTTGCACTTGCACGTGCCGTGCATTCTTGTCTTTGCTTACTAACACTGCTCTTCCAG
GACGCAACCGAGGCCTCTTGGAGCTAGATTTGAAGCTTGACGACCTGTTGGAGATGCAGAAGGACAATCTGGACGACCTG
GATCTGGAATACGTCCAATTTAACGTGCCCAAGGTCCTGGCCCTGCTCAACAAGCGCTTTGCCAGAAAGAAGGGCTGGTG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62