GenePrediction:GLEAN_6480 Details

Name: GLEAN_6480
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:591243..590221 (- strand)
Length: 1023
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:591243..591135 (- strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_168:591060..591021 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_168:590952..590644 (- strand)
Length: 309
Type: CDS
Source: GLEAN
Position: GCSC_168:590587..590221 (- strand)
Length: 367
>GLEAN_6480 class=GenePrediction position=GCSC_168:591243..590221 (- strand)
ATGTCAATCGTGTCGCTTTTGGAAGTCAAAGTCCTCAACAACCCAGCGCGGTTTACGGACAAGTACGAATTTGAGATCAC
ATTCGAGTGCCTCGAGCAGCTCGAAAAGGGTATGCGATCCGGTGATTTGTCTCCTCTTAAATGGAAAGGCGTGTCGGCCG
ACATACTAATTTGCCCTGCCTAGATCTCGAATGGAAGCTCACGTACGTGGGCTCGGCCACATCGTAAGTGTCTTGGTTGT
CCGGCTTCACCGTCTCCCTCGCCGACTGTCCTTCTCACACCGCCATTACAGTGACCAGTATGACCAAGAGCTGGACTCGC
TCCTCGTCGGTCCCATCCCGGTCGGCGTCAACAAGTTCATTTTCGAGGCCGATCCGCCAGACATGAAGCGCATCCCGGAT
GCGGAGATCCTGGGCGTCACGGTGATCCTCCTGACGTGCGCGTACGACGACCGCGAGTTTGTCCGCGTGGGCTACTACGT
CAACAACGAGTACGACTCGGACGAACTGAACGCCGATCCGCCGGCGAAGCCGCTCGTCGACCACATCCGGCGAAATGTGC
TGGCCGAGAAGCCACGTGTCACCCGGTTTGGCATCAAGTGGTGCGCAGCCCCCTCTCTCCCGTCTCAGACCTCGCCCATG
CTGACTCTAGATCCAGGGATTCGGACGCGTCCGCACCGGCGGAATTTCCGCCCGAGCAGCCTGAGGCCGACCTGGTGGCA
GATGAGGAGGAGTATGGTGCAGACGAAGCAGAGGAGGAGGAGGAGGAAGAGGTTCCCACTGCCGGGGAGGCAACAAAGGT
GGGCGAGGATGCTGCCATGGCTGGTACTGAAGAGGCGGCGGAGAATGGCGAGGAGGATGATATCTCAGAAGACGGCAGTG
TCGACATTGAGGGCGAGAGCGAAGACGAGATTGAGGAGGAGGAGGAGGGCGAAGGAGAGGGTGGTGACGAGATGGATGTC
GACTCTGACAAGCCGGCTGGCGCAGCCGAAGGCCACCACCCGGTCGAGGTTATGTCTCACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62