GenePrediction:GLEAN_6482 Details

Name: GLEAN_6482
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:584172..581317 (- strand)
Length: 2856
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:584172..584078 (- strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_168:583575..583312 (- strand)
Length: 264
Type: CDS
Source: GLEAN
Position: GCSC_168:583208..582450 (- strand)
Length: 759
Type: CDS
Source: GLEAN
Position: GCSC_168:582392..582109 (- strand)
Length: 284
Type: CDS
Source: GLEAN
Position: GCSC_168:582053..581317 (- strand)
Length: 737
>GLEAN_6482 class=GenePrediction position=GCSC_168:584172..581317 (- strand)
ATGGCGCTCCGCAGCGAAAATCAAAGCAGACAGCAAGCTGCGACCGGACTTCAGGCCCAATGGCACCAGTTCAAGCGCAA
CATCGGGTGGCAGACGTGAGTATGCCGCAGAGGTGACTGATGGGGCGGCAAAGACGCTGCTCGAGTAGATTGGACTGGAC
GTCCATGATGGACATGATGCGTTCACCTGTGCAGCTGCGAAACGGATGAAAAGGAGCGGCTGCCCGTCGTTTGCTGTCCG
TGCCTCTGCCTCTCTGTTGACATCGCATCTGCTTCCTTCGACAGTTCTGTGTTCTCTCGTCTGCCTGCAGGCTTCTCATC
GTCATCAGAGGAGCACCACCCTTGAGACTGGAGCCACGTCCGTGCTAGATACTCCCCTCTTGGCCCCTCTTGCCCCAGGA
TTAGTCCTCTTGTGCCTCGCTTCTTTCCCAGTCATCCGAGTGTCTGAGAGTCCCATGCTGGCTATGGATACTCGACGCTT
GGCGGCCCCGCTCCGTCCGGCGGTGGACAATATCAGACACGCCTCGCCGCGAGTGGGCATAAAGGAGGCCAGTCTTGTGT
TACGATCGCGAGCCCCATCCAACAATCCGCCTTTTAGGGGCACCGCCTGCCAGCCACCTGTTTCTCTGGCCTCCACAAGC
AGCGAGCTGAGCACAGCTGTGACCAGTCCATTCGTCCTATTCGACAAGCCGTCTGCCGACAGCCGCAGTGAGACGTCCAG
ATCGTCCACACCGGTTACCGACATGTCCAGCATGTGCCATTCCACTGGAAGCAGTTTCGCCACGTCTGTGCAACCGGATG
GCGAATGTGGATACCCCAAGGACGAGGAGAACGATTCTTGTGCGAGCAGATCAGATAAAGAGTATGTCCATGTCGAAACA
CCCAGACAGCTTCGTCCCCGCCTCTTGCTTCACTTTCGCTGCACAAGCCTTACCCGCAGCTAACGCCAGTGTCTTACTTT
TCAGCTCGGATTCGGGCCACGGAGAAATGAGATTCGACGAAGTGGATATCATGGCAACAGCAAAGGAGGCGCTGAACACG
CGGTCTTTGAGAGAGGGCCAACTGCGATACTCCATGTCGGCGCTGTCAGCGCAGTCCGGGGTCTCCGACTCGGGCGAGAG
TGACTACGCTCGTCTTGCTTACGAGGACGACGAGAATCCTGGTGCTTACGAGGACGATGACGATTGGAGCGGCACCGACA
GTCTTGATGCTGCTGTCATTGCAGCAGTGGACGGAGATCTGAGCCTTGCCGCTTTTCTCATCCCACTCTTGCACAAGGAT
TTGCGTAACGCGGTGAGAAACAAGGTGGAATCCTGGCAGAACACATCGACGACCCGACCTCCCAGCTCTGCGACAGGATC
AACGGTGACGCGGGGAGGCGCATCCGGAGCAGCATCTGGAGCAACTTCGGGCAGCTCCATCGTGGCAAGCGGAAGTAGTG
GGGCACAGGACCAGGTATCTAACCAGTCCCGAAAGCGACGGCGCCGGCCGTCTGACTCGGAAGACGACCGGGAGGAGGGA
GAGGACGAGCACGGGGGCAATGGCGGGAACGGTAGCTCAAGACCAGAATTGATCGACGAGCCGTTGTCACCACTTCTGGC
CTGTCCGTTCCACAAGCTCAATCCGTCCAGATATGGAATCCAGCATAACGTCACGTCTGGTTCACGAAAGGATGGATACC
GGGCCTGTGCCGGCCCGGGATTCAAAAGCATCCAACGGTTGAAGTGAGTTCTGCTCAGGGGAAAGCCGAAATCTGCAAGC
GGTATGCTAACAGGGCGAAGGGAGCATCTAAAACGGAAGCACACGCCTGTCCAGTGCGAGCGGTGCTACCTAGTGTTCAG
CGGATCGGACAAAGCGAGGTGCATCAACGAGCTGACTGAACACCTGAGGCTGGAGGTGCCATGTCAGAAAGGGGAGTCTG
TGTTGAAAGAGGGGATCAGCGAGGCCCAATGGGCGGCGCTGGACAAGCAGAACAGGAAGAAGAACCAAGAAAAACACAAG
CTGGAGAAGTGGTTTGAGATCTGGCGCGTTCTTTTCCCTGAAGTTCCGGAGCCAGAGACGCCTTGTAAGTCCAGAAGATC
GGTTCGGTGGTCGAGTGGAGCGCTAATTTTTGCTTAAAGGGTACAACGAGGTGACACAAAACCGGTTTCCGTCGCCGTCG
CGGGAGAACGAGGCGTTTGCCGACCTGTTTCTGCACATCCTGAACCATAAGGTGCAGCAGGGCGACATCAGCTTCCCGGG
CTGCAACACGGATGACGTGCAGCAGCGGCTGCGGAATCTTGTGCAGCAGACATTCCGGACATATGTCAACCTGCATGGGC
CGATGTCGCGGACAACAGAGACGACGTCAAGCCAAACAGGGACCAACAACGTGCACTCGTCACTGGTTGGCGGATCGTCA
ACGCAACAGTCTCGTCCGACCAACAGCATGTCGTTGCCGGCGACAGCAACGTCCCACACAACGGGCACCGTCATCAGCCA
GATGCACGCGCAGACAACAGGGCAGTATGCGATGAACATGCCGGCGGTGACGACGGTCGGCGTTCCGGGAATGTCGTATG
CTGTTCCGATGCCCCAGAGGCCGAACAACTACGCCCAGTACCACCACACGCCGATGAGCGTGACGTCGATGCCGGGACAG
GTGGCAAGCACTGCGGGCACGGCAATGCAGGCCAGCTTCACGGGCAACGGACAGGAGGAAGTGTCCATGTACTACTCGAC
ACCGATGATGCACTGGCAATCTGCCGGCATGCAATATGGAGCAGCGCCGATGTCAGCCGTGCAGTACCCGGGCGATTTCT
ACGGCGCCAATGGGTACATTCCAGGTCCAGGGGCTGACTACAGCAACTGCCGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62