GenePrediction:GLEAN_6484 Details

Name: GLEAN_6484
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:563266..562176 (- strand)
Length: 1091
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:563266..563211 (- strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_168:563146..562980 (- strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_168:562915..562176 (- strand)
Length: 740
>GLEAN_6484 class=GenePrediction position=GCSC_168:563266..562176 (- strand)
ATGGAGCATCCGCGCAACACGTTTACGGCCGGTGTGGTCAATGCGATGCAGAGGCTGTCAGGACCCCACGGTTTTCTTCT
CGTTTCACGGACGAAGCTGTGTTGCTGACTGTTGGCTCAGATATCCGCTGGAGTATGCCGACTCGGCTTGGGACAACGTC
GGGCTGCTGCTGGGGAACCTCGAGGAGACGGAGCCATTTCGGAACCGGGTGCTGCTGACGACGGACCTGACAGCGAGCGT
GGTGGACGAGGCGATCCAGTACGACGTCTCTGTGATTGTTGCATACCGTGGGTTTTTCTGTCTCTGTTTTTTTCTTTTCT
GTTCCCCATCTCCTTCTTTGCTGACCGGCAGACCCGATCATCTTCCGGGGCCTCAAGGCCATCACGCCGGCCGACACGCA
GCAGGCGTCGCTGCTCCGGCTGGCGCAGAAGAACATTGCAGTGTACTGTCCGCACACGGCGCTGGACGCGGCCAAGGGCG
GCCTGAACGACTGGCTGGCCGACAAGGTGGAGGAGGCGGCGGCGGAGGCTGTGGGCACGGCGGCACACGTGCTGGACGGC
AGCCGGCGGACGACGCTGAAGCCGGTGCGCGGACCCGAGAGCGTCGTCGGCTACGGACGCCAGGTGGACCTGCCGGTGGC
CGTCGACGCGTTTGCGCTCGTGCGCAGCTTTGCGCAGCGGCTCGGTGGCATGCGTCACGTGCTGATTGCGCCGCCGGCAG
ACTACCGCGACGGCTTGGACGTGGCCGAACACCTGCTCGTGCGCTCGGTGGCCGTCTGTGCCGGGTCCGGCAGCGATGTG
CTCAAGGCGGCCACCTCGGCCAAGATGCTGCTCACGGGCGAGATGAGCCACCACGACGTGCTCGCGGCCGTCAGCCGGAA
CCGCTGGGTCGTCTGCGTGCTGCACAGCAACTCGGAACGCCTCTTCCTCGCCGAGACCCTGCAGGCACAGCTGCAGCACC
GCCTCGCCGCCGGCCATGACGATGCCAAGGTGCTCGTCAGCCAGAACGACCACGACCCCTTTCTCTTCTGGGATGTCAGC
GAGCCACCGCCGAGCGGACAGAAGCCGCTGCCGGCAGCGTGTGCCATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62