GenePrediction:GLEAN_6487 Details

Name: GLEAN_6487
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:550101..548397 (- strand)
Length: 1705
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:550101..549844 (- strand)
Length: 258
Type: CDS
Source: GLEAN
Position: GCSC_168:549785..549539 (- strand)
Length: 247
Type: CDS
Source: GLEAN
Position: GCSC_168:549484..549370 (- strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_168:549302..548489 (- strand)
Length: 814
Type: CDS
Source: GLEAN
Position: GCSC_168:548432..548397 (- strand)
Length: 36
>GLEAN_6487 class=GenePrediction position=GCSC_168:550101..548397 (- strand)
ATGGCTGTTGACATGGAAAAGCATGCCGTTGAGGGCGATACCTACGCGGTCAAGCCAGAGACCACATTGGTCGAAGACGC
AATGACACCCGAGTTCACTCTTGCCGAGCAGAAGAGCATCATGCGCCGCGTCGACCGACGCCTCGTCACCACCGTGGGCT
TCATGTACTGCGTCTCGCTGATGGACCGCACCAACCTGGGAGCTGCCAACATTGCAGGCCTGGCAAAGGATCTAAAACTG
ACAGTCGGAGCCCGCTATGTATGCTATAAACTTCGGCAGAACATGTGCGATCTAGGCTGACTCTCCGCTCTGGCAGTCCA
TTATCAGTTTGGTGTTCTTCGTCCCGTACATCATTTGTCAGGCGCCGTCGACTGTCATCGTGCGCAAGGTCGGTCCGCGC
CTGCACCTGTCGCTGATCACAGTCTGCTGGGGGGCCGTCATGGTCGGCATGGGCTTTGTGCCCACTTGGGAGGCTTTGGC
CGGCTTGCGTGTCATTCTCGGTATCTTTGAGGCCGGCTTCTTCCCCAGCTGCATCTATCTTCTGAGCACCTGGTACACGC
GATGTGAGCACAGAATGGTACAGGTCTCGATGGCAAGCGCAGGCTAATCGTTAGCAGTCGAGGTTGGGAAGCGCAATGCC
GCCTTCTATATTCTGGGATGTGTGGCCTCAGCCTTTGCCGCCATCCTTGCCGCTGGCATCATGCAGATGAAGGGCCTCGC
TGGTCTTAACGGGTTTGTCTTTTTCATTGTCTTTGCCGGCCGTCTTTCCAAGCAGCACACTAATACACAACACGACCAGC
TGGCGTTGGATCTTCATCACTGAGGGATACATCTCGTGCCTGATCGGCATTGCAGGCTTCTGGCTTCTCGTGGACTTCCC
GGACTCCAAGCGAAAAATCTGGAATTTCCTGGGTGATCGCGAGCGCGCCTGGGTTGTTGCCCGTGTGAACGCCGACCGCG
GCGATGCTGTGATCCCGCCGTTCAAGTTGTCGCAGTATTTCCGCAGCGGCCTCGACTGGAAGGTGTGGGCCTATGCAATG
ATTTTCTTTAGCACAACAACGATCACGTATGCGCTTTCCTACTTTCTGCCCGTCATCCTCCAGGAGAATATGGGCTTCAC
GACAGTGCAGGCTCAGTGCCTGATCGCCCCGCCTTACGTATTTGCCGGATTGGTCATGTTCTCGTTGGGATACATCGGCG
ATCGCTACAAGGTGCGCGGGCCGCTGATCGTCTTCTGCATGCTGCTGTGTCTGATCGGGCTGCCCATCGTGGGCTTCCAC
CCTAACTCGGGCGTGCGCTATTTCGGCATATTCTTGGTGACGGCGGGCGCAAACTCGAACGTTCCGTGCATCATGTCATA
CCAGGCGAACAACATCCGGGGCCAGTGGAAGCGAGCCTTTGCCAGTGCAACTCTTGTGGGCTTCGGCGGCTTGGGCGGTG
TCTGTGGCAGCCTCGTGTTCCGCGAACAGGACAAGCCGGGATACCGCCCGGGCATCTACGCCTGCATCGCTGTGAGCTTA
GTGACGCTACTGCTTGTCTGCGCTTTGAGCCTGGACTATCGCTCGCAGAACCGAAAGGCCGATCGCGGAGAAAAGGAGCT
GGAGACACTCGAGGTGAGCAATACTGGCGAGAAGCTGTCGTTACAAATTAATGACCGTTTCGTTTCTAGGACGGCTACCT
GCCAGGATTCCGGTACACTCTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62