GenePrediction:GLEAN_6490 Details

Name: GLEAN_6490
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:540346..538408 (- strand)
Length: 1939
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:540346..540305 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_168:540111..538408 (- strand)
Length: 1704
>GLEAN_6490 class=GenePrediction position=GCSC_168:540346..538408 (- strand)
ATGCGATGGCCACGAGCCGTGCGCGACATGCACGGCCTACGGGTACGAATGCACGTACGCGAGTGCGACACGACAGCGGC
GAAAGCGACCGCGGCAGCCGCGGGTAACGGCGGCGGAGACGCTGCGGATGACGCCGCCGGCGGAGCGAGCATCAACAGCA
GCAGCAGCAGCAGCAGCAGCAGCGGCGGCAGCAGCGGTGGAGACGGCGGTGGACGACGGCTGCGGGCTGGCACAGCGGCT
GGAGAGCAACTCGGGAGCGGCATTTGTGCGACGGCTGGGACTGAAGATCGACCCGGCACGAGCGCCGAAGCTGAACCTGT
TTGGATGGAACGTGGGCGAGCGGCAGCTGTCGATGCGGCTGAGCCTGAGCGCATCGACGCCGGTGCTGTCGGTGGTGGAG
ATCACGTCGCAGGAACACGTGCAGGCGCTGGCGCAGTTCTACTTTGACAAGGTAGACCCGTGCTACGGCTTTCTGAACGG
ACGGGTGTTTGCCGACCGGCTGGACCGGCGCTTCCGCCAGCAGCAGCAGCAACAACAACAAGCACCAGCCGAGCCGGACG
TGTACGACAGCGTGATCGCCGGCGTGGCCGCGCTCGGCTGCCTCTTCTCGCAGGGCGCGGCCACGCTGGCAGAGCTGCAG
CTGGTGCGCACGGCATTCCACGCGCTGCATGCACAGCGGCTGGCCGGGCCGCCTGGCATCGACCTCATCACGGGCTGGGC
GCTGCGCACGGTGTACCTGCGGCTGACCGACTCGCCATACGCCGTCTGGATGGCCAGCTGCACGCTGATGCACCTGGTCG
AGGCGTCAGGACTACACGGCAGCAGCGCTGTCATGGCGGCCACGACGGCCGTCGCCGGCGAGGTGGACCTGGCCGAGCCC
GAGAATAGCGGTCCCGGGTCGCCGCCCGGCGACGGCTACGTGGACCCGGTCATCGCGGCGCGGCTGCTCGGCATCGCCCA
CCACCTGCACGTCTGGACGTCCTTTGACCTGGGCCTGACGCGCGTCGCCTTTCTCAAGACGGACCTCTCGCTGCCGCCGC
TCTGGGGACAGGGCGAGCCGGAGGACGAGCCGAGTGGACGCGGAGAGGCTGCGTCGGCCACCCGCCCCTCGGCCGCTATC
GGCGACGCCACCGCCGAGCTGCTCGGTCTCCTGCCGATGTCGGTGGATCTCGATCCCGCTCGTCCACGTGACGCGGCCGA
TCTCACGGCCACGCTCGGCCGCCTGCTCGCCGGCACCCACACGCTGGCGCCGTCGGTTCTGGCCCAGTGTAATCTCGTCC
TCTGTCTGCTTCGACGCTTCCACACGCAGCACCTCGACGTGGCGCCCGAGCTCGAGGCTCGCGTGCTGGCTCTGCTGCGC
CGCGGCCTCGCCTGCGCCCGCGATATGGTCCTCAGCTGCAGTCCCTGGCACCAGGCCTCCAACGTGCCGTTCCAGACCAT
CTGCATGCTGCTTGTGCTCGACACCCGCTCGTCCCTCGCGCTCCTGCCCGAAGCCATGCAGACCCTCGGCCTCGTCGCCT
CCGTCTACGATACCGACCGCATGCGCGAGGCTCACAGCGCTGCTCGTCTGCTCGTCCGCCTGCATCAGCAGCGCCGCCGC
GACGACCTCGCCGTCCTCGGAAACGCCCTCCAGCGCCAGTCCGAGCCGCCCGTCCTGCCCGTTCCCGCCCAGTCTCAGAC
ACACTTGCCGCAGTCCCATACAGAGACGCCGTCGCAGCCACACATACAGCCACATATACAGCCACACGTTCAGCCACATA
CTCAGCCACAACCGCTCCCACAGCAGTCCTTACCCCTTCAGCTCGACCTAGGCCCCAGCGAGGAGGAGTTCTCTTGGCTT
GGCGCCCTCGTGTCCGACCTGCCCGGCCTGCAGCGCGTCGATCTCGAGCAGTTCTTGTCTACTGATCTGATCGACGATCC
CTCCCTTATGGGACTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62