GenePrediction:GLEAN_64 Details

Name: GLEAN_64
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:423289..424881 (+ strand)
Length: 1593
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:423289..423513 (+ strand)
Length: 225
Type: CDS
Source: GLEAN
Position: GCSC_179:423620..423967 (+ strand)
Length: 348
Type: CDS
Source: GLEAN
Position: GCSC_179:424009..424881 (+ strand)
Length: 873
>GLEAN_64 class=GenePrediction position=GCSC_179:423289..424881 (+ strand)
ATGGAGCCTGTACAGAAGAAGAAGAAGACTGGAAAGGAGAAGGTGAAGGTGGCCAAGCCAGTGGCGAAAGTGACAGAGCA
GCGGACGAAGCAGCGGATGGAGCAGCCGGCTGAGACACCAGACTTGGTTGAGGATTCAATGGACGAAGAGGAGGAAGAGG
AGCAGGGAGAAGAGCAGGGGGAAGAACAGGGGGAGAAGGAGGCGCCAAAGACGTTCAAAGAGCTTGTGAGTATGACTGGA
AAGAGGAGTGAAGATGAGAGAAGACGAGGGACGAGGGACGAGGATTGAAAGAAGAAGGACCAGTCGAGAAAGACAACTGA
CAAGGAACCAGGGACTCGTCGATGCGCTATGCGAGGTGTGTGAGATGCTCGGCTACACGGCGCCGACGCCGATCCAAGCG
GCGGCAATCCCGGTGGCACTGAAGAACCGGGACATCATCGGCACGGCGGAAACGGGCAGCGGCAAGACGATTGCATTTGC
GCTACCGATGCTGCAGGCGCTGCTGGATCGGCCGCGGCCGCTATTCGGGCTGGTGCTGTCGCCAACACGGGAGCTGGCGG
TGCAGATCGGGCAGACATTTGAGTCGTTTGCGGCCATCTCGCTACGCTGCGCGGTGGTGGTGGGCGGGATGGACATGGTG
TCGCAGTCGATTGCGCTGGCGAAGAAGCCGCACGTGGTGGTGGCAAACGGCCGGGACGACTGCTGGACCACCTGGAGAAG
ACCAAGGGCTTCTCGCTCAAGCACCTGCAGTACCTGGTGATCGACGAGGCGGACCGGCTGCTCGACATGGACTTTGGGCC
GATCCTGGAGAAGATCTTGCGGCATCTGCCGCGGGAACGCCGAACGATGCTTTTTTCGGCCACCATGTCGTCGCAGGTGG
AGAGCCTGCAGCGGGCGAGCCTGCGGGATCCGGTGCGCGTCAACGTGGCGTCGAGCGCACACCAGACGGTGTCGACGCTA
AAGCAGAGCGTGATCGTGACGCCGACGACGCGCAAGGACGTCTGTCTCGTCTATCTCGTCAACGAGTTCTACGGACAGTC
GATCATGGTGTTCACGCGCACCATCTACGAGACGCAGCGGTTGGCGATCCTGCTGCGGGCGCTCGGGTTCGGCGCGGTGC
CGCTGCACGCCCGGCTCAGCCAGTCGCAGCGGCTCAGCGCGCTCAACAAGATCAAGTCGGGCAGCCGTGAGATGCTGATC
GCGACGGACGTGGCGGCACGCGGGCTCGACATCCCGCACATTGGCATCGTAATCAACTACGACGTGCCGCAGGACAGCAA
GACGTACGTGCACCGAGTCGGCCGGACGGCGCGCGCCGGCAAGTCCGGCCACGCCGTCAACCTGGTCACGCAGTACGACC
ACACCCACTTTCTCGCCGTCGAGAAGGCCATCGGGATGGAGCGCAAGATCCTGCCCTTTCCCATCGACCGCGAGGAGCTG
ATGATGTTCAATCCGCGCGTCGAGGAGGCCCAGCGCCACGCCCATGTCGAGATGCGCACGTTTATCGAGCAGAACGGCAA
GCGCAAGAAGACCGGCCGCTCGGCTGCCGGCGGCCAGCGGCGCCACGATGGAATGGATCGGGAGGAGCACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62