GenePrediction:GLEAN_6524 Details

Name: GLEAN_6524
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:302152..300312 (- strand)
Length: 1841
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:302152..300908 (- strand)
Length: 1245
Type: CDS
Source: GLEAN
Position: GCSC_168:300841..300692 (- strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_168:300623..300312 (- strand)
Length: 312
>GLEAN_6524 class=GenePrediction position=GCSC_168:302152..300312 (- strand)
ATGTCTCCAGTCGTTGAGTCGCAGCCGGCGCAGCAAAACCTGGCCGAAAGCTCAAAAGACAACGAAGTCGTCTCCTCGGA
AGAAGGCAGCGCCAGTGCCAACACTCCACAGAAAAAGGGCCGCTCCCTTCTCCACGTCCCTTCGCGTTCGTCCTCACAGA
AGATCCAGGCATCGCCAACGTCGACCGGTCTGAGTGGTGCCACTGCCAGTGAATCGCGCGAAAGCATTGACGGCAAGTCT
CGTGAATCCAAGAGCAGCTTCGTCGGTCGGCAGCCACCCAACGGCAGCGCGTCGAGCAGGCATTCAGGCAACGGCAACGG
CACCGACCCGACCAACACTCCCATCGACTCGCAGCCCAGCTCTCCCGCCGTGGCACCCTCTCCGAAGCGGAAGAAGGGCG
GCGGCTTCTTGGCCATTTTCGGCTGCTGCTCCGCGCCCGACGATGCGAACGCCCTCGACGGCGACGACCCTCCTCTCCCT
GCCAGCAAGCTGAAGGACATCCCCCCACGCCCGGCCGTCGCCGCCCGGAGGACGGCCGTTCCCATTGAACACCCCCCGAC
CAGTGCCGTTCCCGAGCTATCTGAAAAGGACGAACCTGCCGAGGAAACCCGTCAGCTAGAGGAGAAGTACCAGCCCCAGC
CACAACCTCACTATCCGTCACAGCCGCAACCACAGCAATCACAACCCCTAGCGAGCACATCAGCCGCTATCGCATCATCA
GCCGGGCCGCAGCGAGAATCGGAAACTGCCTCGCTTGAAAACAACACCCCGACGACTGCCTCGACTGTCGTTGCAGGCAC
ACTGAACCGCGATTCGGACTCGAAGCGAGCATCCCTTACCGGTTCGGGCAGCGTGGCACCAACCGTCACAGTTGAACCGC
TACTCCATCCCGAGGTCAAGGAATCACCTGTTGTTGACGAGGCGGTCGAGGAGGTCGTGCCGCGTTCCTCCGAAGACGAC
AATGCTGAGATGTCTGAAGTAGATGATGTCGCTCCATCTACACAGCATGTGGATGAAGACGTGATCACTCAGGTTCCCGA
GGTGCTTCCTAGCGTGCCACCCCCACCGCCAGGCCCGGCACCTGTCGCGTCAGTACAGGCTGGCAACACCGATCTGTCAA
CCATGGAGCCGGCTATCGAGTACACGCAGCCAACGGCCCTGTTACCCCCTATTGAGCCGCATCTGAAGGGCAGGAAGTGC
TTAGTGCTAGATCTGGATGAGACCCTGGTGCACAGTTCTTTTAAGGTACGCACGCTTCTCCAACCGATGCGATGTGCATA
CTTCCAAAAACATACTCTTAACATCGCACAGATACTCCACCAGGCCGACTTCACCATCCCGGTCGAGATCGAAGGCAGCT
ACCACAACATCTACGTGATCAAGCGGCCAGGTGTCGACCAGTTCATGAAGAGAGTTGGTGAACTGTACGAAGTCGTCGTC
TTCACGGCATCGGTATCAAAAGTATGTAACTCTGCATCCCGGCCATCTCTTTGTTGGAATACGTCCGCTGACAATCTTCT
TCACAACAGTACGGCAACCCACTGCTGGACCAGCTGGACATTCACAAGGTTGTCCACCACAGACTCTTCCGGGAGAGCTG
CTTCAACCACCAGGGCAACTATGTTAAGGATCTGTCCATGGTTGGCCGGGACTTGAAGGATACGATTATCATCGATAACT
CGCCTACTTCCTACATATTCCACCCACAGCACGCCGTGCCCATTAGCAGCTGGTTCTCCGATGCACACGACAACGAACTG
CTTGACCTGATTCCTGTTCTGGAAGACCTCGCTGGTCCTACTGTTCAGGATGTCAGCCTGGTCCTAGATGTTACTCTTTA
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62