GenePrediction:GLEAN_6525 Details

Name: GLEAN_6525
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:298813..297843 (- strand)
Length: 971
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:298813..298792 (- strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_168:298372..298154 (- strand)
Length: 219
Type: CDS
Source: GLEAN
Position: GCSC_168:298052..297957 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_168:297877..297843 (- strand)
Length: 35
>GLEAN_6525 class=GenePrediction position=GCSC_168:298813..297843 (- strand)
ATGCGTGAGGCTCTTGACTTTAGTAAGTGACATCTTGAAGCTTAAATTCCAAACTAGCAGGGGTTCGCGTCCCTTGTCCG
GGCTCTCGGGCCCGGAACAATAATTATGCACCAGAGTCATTGCATAGTAAAAGAATTGTGGGGCGCCGTACTGAGTGAAT
CAGGAGCTGGTGTCGTGGCCTCAATTTGCACGCGAGTCGACTCCTTTTTGGCCAATTCATTATACGACCGACTCTCTTTC
TGCACTTCACTCCGAACTAACAACAACACATTCACGCCCGACCGTCTCTTCCCATCCGGCTCGTTTCTTTCGTTCTTCCG
TCTATTCGCTCACTTGGCGTCCGTTTTGTGCTTGCCTTCTTGCCCAATTGCCGTCCCGTTTCATCATGGTAGGAAGATCT
TTCCCCGATCGTCGCATTACTTTCGGCCTGTCGCTAACCAGCCCAGTCTTCACCACGCGCTTCTTCCCCGACGCCTGTCG
GCGCCTCTACTGGTGCCGCCGCCAACCGTGGCGCCTCGCCCTCGCCGCCGCCCCCACCAGGAGGTGCCCGCACGCAGATC
CGCCGTCGCGCAGCTGCCGATCAGAAGGAGAAGGCTGCCAATGCGCGGCCGAGCAGCACCCGGGCTGCGGGTGCGGGTGG
TAGCAGCAGCACGATGTTGAGTACGTGCGGCCGATGGTAGCGCCTTTTGGAAGATCTTCGAGAGCGCGCCTGGCATGGCG
TTGCAGAAGCCGTCGTTCACAAAGTGCTGACTGTAATCTAGGACTGTACACCGATGAGTCGCCTGGCTTGAAGGTGGACC
CCGTGGTGGTACTCGTCTTGTCGCTGGTGTTTATCTTCAGCGTCGTTGCTCTGCACAGTATGCTTCCACCCTTTCCCAGT
CTGCATTCGTGTGCTTTCATCCTGGTCGGTGCCTTATTAACCTTCCTACTTTATAGTCATCGCCAAGATCACTCGGCGAT
TCTCGAGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62