GenePrediction:GLEAN_6526 Details

Name: GLEAN_6526
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:295417..293518 (- strand)
Length: 1900
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:295417..294995 (- strand)
Length: 423
Type: CDS
Source: GLEAN
Position: GCSC_168:294922..294274 (- strand)
Length: 649
Type: CDS
Source: GLEAN
Position: GCSC_168:294209..293518 (- strand)
Length: 692
>GLEAN_6526 class=GenePrediction position=GCSC_168:295417..293518 (- strand)
ATGGCCACAGGTCGCTACAAGCTCGATCCGCTGGCCGACTCGGACACGGGCACGTCAATGCAAGAAGAGCTGCGCCCCGA
AGGTGTTCCCATGGAGTCGGGGCTTGGCCATACGGCAGCCACATCTAGCAGTGATGGCACCGTTCTGGAATCGGACATGG
CTGGCGGCAAGATCGAGAGAGTCGACAACAAGGCCGTTTTCAGGCCGACGCGCAGCTTCTTCCTCGCCTTCTCCGCTCTG
ATGGTGGTAACCATTGCTATCGCTCTGGATGCCACCAGCATGTCTGTCTCGCTGTCGAGCATCAGTGCCGCACTTGGCGG
CAGTGCTCTGGAGGCTTTCTGGTCAGGCACCAGCTTTCTTCTGGCCAGCACGGTGCTGCAGCCCACAGCTGCGTCTCTGA
GCAACATATTTGGGCGCAAATACGTGCGTCTTTTCCTCCCCCTGTCCGCTTCCCTTCTCTGCTTCTCTGTCTTGTCGTCC
GGTCTGACAAGTTAGCTCATATATGTCAATGGCATCTTCTTTTTTGTCGGCTCTCTCGTGGCCGCCTTGGCCAACAACTT
CACCGTCTTGATCGTCGGTCGGACCATCCAAGGCATCGGTGGCGGTAGCCTCATCGCCCTGACCGAAGTTGTCGTGACCG
ACCTCGTGTCGCTCGCCTTCCGGCCGACCTGGTTCTCTGTTCTTAGTGCCATGTGGAGTCTGGGAACTGTTAGCGGTCCG
CTTGTCGGCGCCGCCTTTACCCAGAACGTCAGCTGGCGCTGGATCTTCTACATCAACCTGCCCATGATCGGTGTCGGCAT
GGCTTTTATCGTGCTCTTCTTGCATCAGGCCAAGATTCCCGGCGGCATCATTGCCAAGACGTTGCGCTTCGACTGGGTCG
GCTCCGTCCTGTTCACCGCCAGCTCTACCTCTTTTCTCTACGGTCTATCGACAGGCGGCGTATCAAATCCTTGGAGCTCC
TACCGCGTCTTGCTGCCGCTCATTCTGGGGTTCCTTGGCACTGTTGCCTTTGGCTTCTACGAGTTCCGTGTTGCCCGCGA
ACCCATCATCAACCGGCGTATCTTTAGCAACCTTGACATAATCCTCACGTACATCATGACTGTACTGCATGGCGCCATCC
TCTGGTCGGTGTTGTACTTCTTGCGTAAGGCTTCTCTTTCCTTTTTTGGCGGCCCCTGTTAGACTTGTGCTTTTGCTGAC
GCTACCAGCTCTCTACTACGAGGCTGTCAAGGGATATTCAACCGTCATCACAGGCGTGGCCGTGCTCCCAATAACATTGA
CGGTAGCACCGGCAGCTTCGGCTGTGGGAGTCATCACGGGAATCACCGGTCGTTACCGGTGGTCTATCTGGATCGGCTGG
GCCCTGACCACCATGGGCTCCGGTCTGCTTCTCTTGCTGAAACCAGACACCTCGGTGGCGGCCTGGATCTGGCTCAACGT
TCCCTTGGGCGTAGGCACCGGCATGCTGTTCCCAGCCATGGGCCTGTCGATCCAAGCGGCCTGTGAGCCTGTCTTGAACG
GTCAGGCTTCTGCTTTCTTCTCCTTCCTGCGCACCTTTGGCCAGTCCATCGGTGTGGCCGTCAGCGGTGTCATCTTTCAG
AACTCGTTTAAAAGGAAGCTCGCAGCTCTGCCTGCATTTGCAAGCCTGGCCAACCAATACTCACACGATGCCACATCTGT
CGTCGCCATAATCCGGCATATGCCCGCTAGTGTCGAGAAAACTCAGTTGGTCAAGGCTTACAATGAAGGTCTGCATGTCA
TCTACGTTTCCATGATAGCCTTTTCCGCCTTCTGCTTGATTCTTAGTGTTTTCCTCCGTGGTTACAGCCTAAATCAGGAA
CATGTCACCAGCCAGGCACTGATAAACAACGGCGAGGAGGTGAAAACTGAGAAAGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62