GenePrediction:GLEAN_6527 Details

Name: GLEAN_6527
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:277229..273851 (- strand)
Length: 3379
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:277229..276807 (- strand)
Length: 423
Type: CDS
Source: GLEAN
Position: GCSC_168:276106..275840 (- strand)
Length: 267
Type: CDS
Source: GLEAN
Position: GCSC_168:275768..275685 (- strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_168:275611..273851 (- strand)
Length: 1761
>GLEAN_6527 class=GenePrediction position=GCSC_168:277229..273851 (- strand)
ATGGCAGGGCCCTGGCTGCAGCTGCACGTCAAACGGATCGGAATTGTCAAGGACCTCATTAGGCGCGGCGCAGAAGTTGA
CCTTCCGCTTGAAACTGGGGACTACAGCAGCGCCTTGGCAGCGGCAGCAGTAGGAGATGGCGTTCTTATGGTTGAGATAC
TTCTCGGAAATGGCGCCGATGTGAATCGACAACTTCGGGCAAAGTACTGCGGTTCTGCTTTGGCCATGGCTGCTTACTGG
GGCCGGAAAGATCGGGTGCAGCAACTGATAGATTCTGGAGCAAGGGTGGATCTTGTACTGCAGAATGGATGTTTCCGTAC
CACTTTAGATGCGGCTATAAGCGATGTGGATGGATCGGAAGATTCAGACAAGGGGTGTTTGAGTATCAAGCAAGGCAAAG
CTGAAGTCGCAGACATACTTCGGGTAAGCAGACAGCCCACAAGATGGTGGAGGAGCTTATCAAAAGTTCTGACCCAATTC
CTAGAAGAATTGTAGGGTACTGTATATCGATGGTCGTAGTACTGTGTCGACTGGCTGCAGCATTAGCGCATGCCTACCTA
TAAGTTTTCATGAATCAGCAAAACGTAGTGGTGTGATCCGCTAAATGCTAGCGGCTGTCGCTAAAGTCCTTCTCCATTCC
GGACGTATTATACTTCATACGGTGTATTGCATTAGGCAGTGGGACCGAACGTTCTATGGGCACCTCCTCGAGTAACCAAT
TTTTAAACTCCTTGGTGATTTTCGTTTGGCTGTACGGAGCACGGAGTAGTATCACAATACTTCAATCAGCTGAATATAAC
TGGGAAAGCCGTCTCAAGATGATCATGGAGGCGGTGACAATGGTAGCCGGTGTTCCGATGTCGCTGGCGAACATCCTTCT
GGCGGGCTTCTTCTTCTGTTCTAGCTTGGGACTATAATTTTCCTGATTAATTCGGGAGGGCGGAGTACATAGTGCATATT
ATGTAGCTATGTAACTCCGCGTGCGATAAGATCATCTCGGCTCGGGTTATCCACGACGCGTGATTTTAGATGCATCTACT
CCGTCTACATGCCCATCTCTCAAACAGCAGCCATTCCGTCCGCACCTCGCTCTTTCTTCACAAACACGTTTCCCGTTGAA
AAGATCCTCTCGAACGAAGACACTCTGTTTTGCGTCAGCCGCCCGATATTACCGCCGCATCCTCCCGAGCCCGTCAAGGC
CAGGGGCATTGGGCCCTTCAATCCCCCATCCGTTCAGGCCGCCAGTTCCAGTTTCATCACGATGAAGGGCTGGACCAAGA
CGACGCGAATATGCGTCATGATGGCGCTCGACACAGTGTTCCTGGCAATTGAGCTGGGCGTCGGCTACTACGTGTCGAGT
CTGGCCTTGATTGCTGATGGCTTCCATATGGTATGCATTGGATGGCGTCATACATATGTATTATGCCAGCGGCTGACATC
TTCTTTCACCACTGTCTTTAGCTCAACGACATCATTTCTCTTGCAGTAGGGCTCTGGGCCGTGAACCTTGCTCGCAAGGA
GTCCAACGACCGGTTCTCCTACGGTGTTTGTCTCTCCCTGTCCCATCTTCTTCTCAGTCTGGTCTCCTGTCTGACCGGTG
TGTCTTGCTCTTCTTCAGTGGCTGCGTGCCGAAATCCTCGGTGCCTTTTTCAACGCCACCTTTCTGATCGGTCTCTGCGT
CACGATCGTTCTGGAGGCGATCCAGCGCTTCTTCGAGCCGCCCAACATCAGCAACCCGGAGATTGTGCTGGTCGTCGGCT
TCTGCGGCCTGGTCTCGAACCTGGTCGGCTTCTGGGTTCTCGGTGGCCACGGCCACTCGCACGGTGCTGCTGATGAGGAG
GCCGGTCACGATCATGACCACGACCGCGCCCACGTACACGACCACGTTCACGATCACAGCCATGACCACGGCCATGTCCA
CGCCGATGCTTTCGTGGAGAATGGCGTGGACAACCCGGACGACTGCCCGGACGAGGACCGCGACGAGGAGCTGGCCATCG
AGGCTGCCCAGACGGACGGTACCACGGCCTCTGTCGACGGACTGCGCCACGTCTCCTTCACGCCACTCGACGGTCGGGGT
TCTGCACAGTCCCGAGCCACTTCTACTGCACGTCGGCGTGCCAACAGCGGCCGTCGTGTGCCGACGTCGATTGAGGATCT
CAGCATCCACCCGGCCAGCTTCCGGCAGGACCTCCGCGAGATGATCACGGCATGGCCGACGCGCGACGACGACGTCGAGG
AAGAAACGGACTCGGACTCGACCGGCGAGAACGCGCAGACCAGAGGCACGACCGCCAGCAGCGCCACCGAGCGGACGCCG
CTGATCAGCAGGTCGCAGCTTGACGGGGCTGCCGACAGCGTGTGCCAGCACGACGCCAGCGGACACCACGAACACGATCA
CGGACACGATCACAATCACACTCACGGCCACAGCCACAACCCTCACGCGCACCAGCGGCCACGACGCGATTCGCACGGCA
ACCACCACCACAGCCTGCCCAAGGACCCCAGCAAAGCCGGCGGTCACGGTCACGGCCACAGCCATGGCGATATGGGGATG
AATGCCATGGTGTTGCACGTGATCGGTGACGCTCTCGGCAATATTGGCGTCATTGTGACGGCGCTCATCATCTGGAAGAC
GACGTGGGCGTACCGGATGTATGCCGACCCTGTCGTCTCGCTGCTGATCACGGCCATCATCCTGCGCTCGGCCATCCCGC
TGACCAAGGCCACGTCCAAGATCCTGCTGCAGGCCACGCCCGACCACATCGACATCAACGACATCCGCGAGGACATCCAG
GACCTCGCCGGCGTGCTCAGCTGCCACCACGTCCACGTGTGGCAGTTGTCGGACTCGCAGATCGTCGCCTCCATGCACGT
CGAGGTATCCTTTCCCATTTCCGAGTACGGCGGCGAGAAGTACATGAAGCTGGCCCGCCGCATTCGCAAGTGTCTCCACG
GTTACGGCATCCACAGCGCCACCATCCAGCCCGAGTTTCGCCTCGGCCAGGAGACTGCAAAGGGCACCGGTACTGGCAGC
GGAAACGGAAACGGAAACGGAAACGGAAACGGAAACGGCTTCAACACCGGCCCTGCTGACCCCCGGCAAGTCCAAGAGCA
GCGCGGCCGCTCATCCCTCAGCCATGGCCACGCCGACAACGGCGAGACCGTTCCCGCCGCTGGTGCTGGCACCGGCGACC
TCGCTGCCGACGGCGCCGCCGATGTCTCCTCAGCGCCCGTTCTGGCCGCCTCTCAGCCCAGCTGCCTGCTCGACTGCGTC
GACGACTGCGTCGGCCTCGGCTGCTGCTCCCAGACGTCGAGGGCTGGATCCCCCAACGCCACTACCCACTCAAGAGACCA
TGACGGCCACTCCCACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62