GenePrediction:GLEAN_6529 Details

Name: GLEAN_6529
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:260106..258324 (- strand)
Length: 1783
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:260106..259627 (- strand)
Length: 480
Type: CDS
Source: GLEAN
Position: GCSC_168:259562..258324 (- strand)
Length: 1239
>GLEAN_6529 class=GenePrediction position=GCSC_168:260106..258324 (- strand)
ATGTCCCAACAGCCAGGAGAAGGTGCCGATACTCAAATCAGCTCGGAGCTCGAATCCTTCCGACAGCAATGGCGTGCCGA
GGTGAAGGCCAAAACGACAGCTCCGGCGAGGGCCGGCAAAAGCGGTCTCGGCAATGCCGGCTCCAGCTCCAGACCGCAAA
CCTATGCTGAGTCATCCGTGCAACACCGCTCACCACCGCTGCCGGCCGCAGGTACAGGCGTGCCGTCTGCGCCTCTGACA
TTGCTTTCTTCCGGAAAGAAGCCAGTGACACGTGATGAAGATGAGAGCTACATCCAACCGTTGTCTTTTGATGAGCCATC
AGTCTCGGCCAAGGGAGGAGACAGCGAAGATGCCCATCATGGTTCTCAGGGAGAGCCACAAGAGCCGGTCTCGGCCCTTG
AGCATTACGAGAAGGCGGTTGAGAAGGAAGAGCTAGGCAGTCTGGGAGACAGCTTGCGGCTGTACCGCAAAGCATTCCGG
GTAAAGAAACGGAGATTCCCGGTATGTACGGTGTGCAGTCTGTGTTCTGACCCGCTCCTTCTAGATGGACAGCGCCGTGG
ACAAGAAGTACAAGAACAAGCACTTTCCGGCACCTGCCCCGACAGCAAGTACCGGCAAGACAGCAGCAACGTCCGAGGGT
GCAGAAAAGCATGAACACGCTGCTAGCGGCAGCGGCACGGCAGCGGCCAAGCCAGACGCGAAGCCGCTTACAATGAACGA
GTTGATAGCCTCATTTGCGGGCCTGGCCATAGAGGCGGCGCCGCCCCCGATCGAGGGCATGCCGGAGCTGCCGTGTCCCC
TGGCGAGTCTGCCGGGCGAGATCCTGGTACAAATTCTGGGCGACGTGGCGGCGCTGGACGTGGACGACTTTGTGCGGCTG
GCGCGCGTGTGCAAGAAGCTGGCGTACGTAGTGGCCAAAGAGGACCAGATCTGGCGGCGCGTGTGCGTCGAGTCTGCGTG
CGGCTTTGGCGGCATGCGGCGCACATGGCAGACGACGATCGAGTGGAAGCCGCTGCGAGTCGACCTGCTGGGCGAGGGGG
GCGACCTGGGCGGGCTTGAGGACGGTGTCGAGGCAGTAGAGACAAAGGGGTGGGTGGAGGACGAAGAGGAGGTGCGGCGG
CGGCGTGAGGCCGAGCAGGCGGCAGCTGAGGCGACGACGTTGGCGCTGCGCACACGCTCCATCTACACGTCGTGGCAACA
CATGTTCCGGGCGCGGCCACGGGTGCGGTTCAACGGTTGCTACATCTGCACGGTCAACTACATCCGGCCAGGTCAGGCGT
CGGCCAATCTGGTGACATGGAACAGCCCGGTGCACATTGTGACGTACTTCCGGTACCTGCGGTTTTTCCGCGACGGCACG
GTGATCGGGCTGCTGACGACGTCGGAGCCGGCTGACGTGGTGCACCATCTGACGCGTGACCAGACGCTGCAGCACCGGGA
CGGGGCGATGAAGTACGCGATGCGCGGGCGATGGCGCATGTCCGGCATCGGGGCAGCCCAGGACAGCCAGGACAGCCCAG
ACAGCCCGGAGGCGTTCTCGTCTCTGGCTGCGGCTACGGCGGCCGAGAACAAGATCGTGGTCGAGACCGAGGGCGTGGGC
AAGTACTACAACCGGATGGAATTCACGATGCAGACGGCCGGCAAGGGCACGCGCAACAACAAACTCAACTGGCGGGGCTT
CTACAGCTACAACCGCCTGACGGACGACTGGGGCGAGTTCGGGCTGAAGAACGACAAGCCCTTCTTCTTCAGCCGTGTGC
GGAGCTATGGGCTGGGGGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62