GenePrediction:GLEAN_6530 Details

Name: GLEAN_6530
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:257707..255574 (- strand)
Length: 2134
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:257707..257422 (- strand)
Length: 286
Type: CDS
Source: GLEAN
Position: GCSC_168:257371..257286 (- strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_168:257205..255574 (- strand)
Length: 1632
>GLEAN_6530 class=GenePrediction position=GCSC_168:257707..255574 (- strand)
ATGGGTTTTCTTCGTGTTCTGCGCAGCGTCTACGACGTCGACACGCTCGACACCCGCTTCACGACCCCGTCCACGGTCCC
CTACCGGGCTGCCGTCGCAGACCGCTACGACAATGGCAACGACTCGTCCGTGGCGGCTGACGACAGCAAGATCTCGTCGG
TCAGGGCCGAGATCAGCAAGCGGGCAGAACCGTCCAAGTGGCGGTCACCCGAGTACTTGCTCTACATCATCCTCATCTCC
ATCGCGATGCCATTCATGTTCTGGATTCCATACAGCGTATCAAGGCGTACGTCCAGTGGCACCGGCCCTTCCACCGCTCT
CATCCTTCGCTGGTAGCCCCGCTGACCGCAGAAGCATCCGATCCTCGCTACTCCAAGTACGAGTCGAAGCTCGCACCCGG
ATGGATTCCTGGCCGAAAAATTGTATGCTTGCCGTGCCTTGTTTCCGGACTCTGCTTCTTCTTCTCATCTCGCTCGCTGC
TCGCTGACCATTGCTTCTCCAGGACATCTCCGACTCGCAGTACCACACTTTCCGCACGAACCTTCCCTTCATGGCCATCC
TCCTCGTCTTCCATCCCCTCCTGCGAAGAGGCTGGAATGCAGTCAATCCGAATCGGCAAAAGGCGACGTCACCGTCGGCA
CGTTCCCCCATGCCGGCCACCGAGCAGGCGGATGCGCGCCTGCAGCAGCGCCTGTCCTTTGACCACGCCTTTGCTTATGT
CTTCCTTGTCGCCCTGCACGGCATCTCCGCCGCCAAGGTGCTGCTGATCCTCTACATCAACTACAACATTGCCACGGCAC
TGCCGCGGCGCTACGTGCCGGCGGTCACCTGGCTCTTCAACATCAGCACGCTCTTTGCCAACGAGCTCGCCAGCGGCTAC
AGGCTGGCCAACGTGGCCTCCCTGCTGACGACCGGTTCGTGGCAGACGGCGATGTGGCAGGGCGATGGTGCCGTCGACGG
CTCGCTGGTCCAATGGGGACACTGGCTGGACAGCTTCGGCGGTGTCATGTCGCGCTGGGAGGTGCTGTTCAACCTGACGG
TGCTGCGGCTGATCAGCTTCAACATGGACCACTACTGGAGCCGGGCCAGCCGTGGTTCCAGCACGCTAGAGGTGAGAAAC
ACTCCGGCAAGCTCACGCTCTCTATTCGACACTGACGCTCCAAAGAAGAAGCAGCTCGATCCCGCGAACCTGTCGGAGCG
CGACCGCGTGTCCATCTCGGCACAGCCCCAGGACTTCTCGTTCCGCAACTACCTCGCGTACATCGTGTATGCGCCACTAT
ACCTGACCGGACCCATCATCACGTTCAACGACTTCATCAGCCAGGCACGCTACCGGTCCGCCACCATCGAGACCCGGCGC
ACGCTGCAGTACGCGGTGCGGTTCCTGTTCTGCCTGCTGGCCATGGAGCTGGTGCTGCACTACGACTATGTCGGGGCCAT
CTCGCAGGCCGCGCCGCTCTGGTCGTCCTACACGCCGGCTCAGCTGTCGCTGCTGTCGTACTTTAACCTGCACGTGATCT
GGCTGAAGTTGTTGCTGCCCTGGCGGCTCTTCCGCCTGTGGGCGCTGCTGGACGGCGTCGACGCGCCCGAGAACATGCTG
CGCTGCGTCAGCAACAACTACAGCACGCTCTCCTTCTGGCGCGCCTGGCACCGGTCCTTCAACCGCTGGCTGGTCCGCTA
CATCTGGATCCCGCTGGGCGGCTCCAACTTCCGGTCCTGGCGCGGCGTCGTCCGCTCGCTGCTGACGTACGTGCTCGTCT
TCACCTTTGTCGCGCTCTGGCACGATATCCAGCTGCGCCTCCTCATCTGGGGCTGGCTGGTCGTCCTCTTCTTCGTGCCC
GAGGTCGCCGCCACCTACCTCTTCCCCCGCCGCCGCTGGGAAGCCCATCTGACCGCCTACCGCATGCTCTGCTGTGCCGG
CGCCGTCATCAACGTCCTCATGATGATGAGTGCCAACCTCGTCGGCTTTGCCGTCGGCTGGGACGGCCTCCAGAACATCA
TCTACGGCATCCTGCACGACTGGCCCGGCGTGCTCTTCTTCGTCGTCGCTTGCAGCGTCCTCTTCTTTGGCGTGCAGGTC
ATGTTTGAGATCCGCCAGACTGAGCTTCGGAGGGGAATCTTGCTGAAGTGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62