GenePrediction:GLEAN_6531 Details

Name: GLEAN_6531
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:250706..247924 (- strand)
Length: 2783
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:250706..249783 (- strand)
Length: 924
Type: CDS
Source: GLEAN
Position: GCSC_168:249699..249160 (- strand)
Length: 540
Type: CDS
Source: GLEAN
Position: GCSC_168:248739..247924 (- strand)
Length: 816
>GLEAN_6531 class=GenePrediction position=GCSC_168:250706..247924 (- strand)
ATGAGGTCCACGGCAACCGAGGCGGCTGCGTCTCTGCAGCGGAATAGCGAACTGGCCATCCGTCTGTCATCAGCCCAGTC
GCACGCAGCCACCCGACAAGGCGGAACGCCTCAGAACCAAATGTCGGCCGATATCACCGCACGCGCAGTACCAAGAAAGA
CTTCGATCCCGCGACATCCTATCCCTTCTATGCAGGAGGCATTCGCCGAGTCGCTGGCGGAGGTGACGTCGGGAACGCTC
TCGCTCAAACCCAAGCTCGCTGTCGACAGCGCTCAAGCTCGCCGCGCCCGGCTAATTGACCAGGACAAGTCAGAGGGGCC
ACCCGCCGCGCTGTGGCGGTATCGCCCCGGCCAGAACTGCCACGAGCTGCGCAAGCTGATTGCCCAGATTGCCTTTGGTG
TCTATCTTCTTCTCAAGGGCATGGCCAACAACAATGCGCAGGTGGTTGCCATCTTGCAGGGCCATATCGATGAGGTCGAT
GAGTACCTGAGAACGGCCATGGACGATCTTACGCTCGCCAATCAGGACCTCGCTACCCGGCTAGAGCATCTCAGGCTTCC
ACTGAGTGATCTGCCTGCCTTTGAGGATATGCTCGAGGACCGGGCCTTCCGCCTCCGCATCGTCGAAGGCAATGTCCGGA
TTGAGCATATTTTGTCGCGAACCGGCACCGCCCTGCTGCAGGCGACAGAGGACATCAATGAGGGCCTTCGTTCGACAAAG
GATTTCAATGCCTATCTTTCTTCTGAATCTCAAGGCCCCTGGCACGCTGATGCCGATGTTGCCGACATCTATGAAGCGAT
GCGCGGCAATGCCGAAGGCTGGCTGAATGCCTTTACCGATATGGAAGAAAAGAGCCACACGCTCGGAATCCTCATCGCCA
AGCTGGCTGAAATGGTCACTAAAATGGACAATTGTGCCGGTGAAGTGAGCCGTCGAACAAGAGTAAGAACATGCGCTTAT
CTTTCAGTGTGAATTTATTGTGTGTCAGGCTGACCCTGTCGCCCTAGTTCACCATACAGCCGTACACACTGCCGGAAGAC
GACGTTGGGCAAACATATCACATTTCACAGATATCAGAAGGCTCGCAGGAGTCCTCAAATGACTCGTCTCACGAAACGAC
TCCTCCAGACTCTCCAGGTGCCCAGGCCCATGTCCCACAGGAGCCTCCCCGTCTCTCGCTGCGGCTTAGTGTCCTGGACA
GTAGTAGCCTGACAGCAGATTTTCTCGATCTCGGTTCAAGAAACAGCCTCTTTGGCGGCGATGCTATGTTCTCGACCTGG
ACCCCAACCTCAGGCACGGAAGAGAGGAATAACGCTGCCATCCAAGCCGAAAAAGCGGACGACCAGCGACCCCATGAGCT
CGCGATCATGTTAGACGCAGGCCCAGGCACGGAGTTTCATGATCGCCGGTCTAGCCCGGGTGGACGCGAAGAGAACGGTG
GCGAGAGGATCGATACCGACGCCGCGGATGCATACGATTTGGACATAGATGATGACAACCTTTCATCTATTCCGCTTCGC
ATTGACATTGATTCCCCAAAGCCGGTCGTAAATAGAGCATTGAATCACCATATGAAACCTGAGAACAGTTTCTTTAACGA
CGAGGATGATGAGGACGATGAGGATGAAGAGGATGAAGAAGCTGCAGAAGAAGCAGCAGAAGAAGCGGAAGCTGAGGCGG
AAGCAGACGAAAAAGCAGACGAAGCGCCACTGTACCTTCTTCAGCCACGGACCTATACTCCGCAACCGCCTGCCCCGTTG
CCATCGCCGATGGTGCACGAACGCAATTCATACCTGGCGTCCTCAACTTCACCTTCGCCTTCGCCATCGCCTTCTCCTTC
ATCATCGCCATCGCCATCGCCAACGCCATCGCTACGACAGCAGCAGCAGCAGTACCACTACTACAGCCACCATCCGAGAG
CCGACAAAGGCGCACCGCAACTCTCGGTTCGTCCTCCTCCAGAACAGCCAAAGTACCGAGCCCCTTCTCCGGCTGCACTG
GGCCAGGCTACAGCAGTCCACCTGCGCCCAGGGACTGGCCGCAGCCACGATGGAGGAGACAGGCAGATCCCGCATAGACA
GCTTTCGATGCGCTCACCGGTGCCCTCGGAATCTTCGTCTAGACGGACCGAGACGAGTGGTACTCCATCCAGAAAAAGAA
CGTCTCTTCGTGAGCGAATTTCGCTTCGCACAGCACCACCGGAGGCGATCCTTGTACCGGCACCAAATGCGCCGCTACTC
CAACGACCGGTGTTTGCGTCGCCACGGACCTACCAGAACTACAGGACGTTCACTGGCCCAGACTCGGCCAACAGCACGGA
TCCTGAGCGAACCCTTGCTCCATATTACGCGGACGAAGTGGTGCACCCGAAAAGCAGTGCGGGTGCCGAATTCAATCCGC
CCGTCTTTCCCGGCATTCTCCCGTCTCCACACTCGGATCAGCAATTCTTCCGCCCTGTTCAGGCAAGCCCACATTCGCCT
CTGCAGCAACGGCCTCACACAGCCGGCCAAGTCCCGATGCGATCCCACCACCTCCGTAATGCACCGTCGTCGATGGGCAT
GAGCACGCTGAGCAGTGTCACGACGATGACGCAGGACTCAGAGGCCACCAGGCGAACGGTCAAGAAAAAGCGGAGTGCGT
TTGGGTGGCTCAAAAAGGCCTTTACTCTGGACGACGATGAGCGTGCGGAATTTGACCAGCGCAAGAAGCAAGCTCAGCAG
AACGCGTATTTCGAGTCACACTCCAAGGGCCCGAAATTCCTCGACGGCCGACGGGTCCGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62